Разное

Чай кудин отзывы: 16 отзывов на Чай Кудин (Горький чай из провинции Хайнань), 100 гр. от покупателей OZON

Содержание

Чай кудин — польза и вред, отзывы

И снова мы приветствуем Вас, дорогие любители хорошего чая, на нашем сайте, на этот раз для того, чтобы рассказать про чай Кудин или, как его еще называют – «Кхудин». Названия у чая китайское и если его перевести, то получится словосочетание «горькая трава».

Как следует из его названия, напиток относят к горьким чаям (Кху Ча), несмотря на то, что фактически к чаем он не является, так как его приготавливают вовсе не из листов чайного дерева, а из листьев падуба парагвайского.


Полезные свойства чая Кудин

Напиток обладает рядом целебных свойств. Во-первых, он улучшает работу пищеварительной системы, что немало важно, ведь мы не всегда едим только полезные продукты. Да и тем, кто полностью перешел на здоровое питание такая профилактика не повредит.

Во-вторых, кудин приводит в норму артериальное давление.

В-третьих, с его помощью можно понизить содержание сахара в крови, что в целом будет полезным для каждого. В дополнение можем перечислить такие свойства напитка, как жаропонижающее и мочегонное. Они, несомненно, играют важную роль, особенно мочегонное, ведь, как вы знаете, этот процесс помогает высвободить токсины из организма.

Так же кудин является природным антиоксидантом, нормализует углеводный и липидный обмен. Есть предположения о том, что отвар этого напитка останавливает кашель, благоприятствует удалению флегмы и препятствует образованию раковых опухолей. И считается, что регулярное употребление этого чая защищает от радиации.

Но это все из уровня биологии, а на уровне обыденного сознания напиток дарит заряд бодрости, поднимает жизненный тонус и просто освежает! Разве не эти три компонента все мы ждем от чаев? Кстати, известно, что китайская медицина славится во всем мире, так вот китайские врачи любят Кудин за то, что он помогает поддерживать функцию сердца.


Приготовление чая Кудин

Да, сейчас переходим к практической части. В принципе тут нет ничего сложного, приготавливается Кхудин точно так же, как и чай. Берется сухая заварка, которую заливают водой и, определенное время настаивают.

Самое важное, на что следует обратить внимание – это температура воды. Для полного раскрытия вкуса нужно придерживаться следующих цифр.

Если вы для заварки используете воду с температурой 50-60 градусов, то вкус напитка окажется тонким и благородным, если же вы используете воду с температурой около 100 градусов, то ждите от напитка горечь полыни.

Да, немногие знают, что на вкус может повлиять температура воды, но, как вы можете видеть здесь, да и проследить на практике, это имеет место быть. Самого же Кудина не стоит брать слишком много, для заваривания на одного человека вполне хватит

одной или двух иголок.

Иголки – это форма листьев напитка. В целом, теперь вы знаете все то, что полезно знать об этом напитке. Можем лишь заметить, что вкус у него довольно специфический, и невозможно сказать, что это тот напиток, который нравится всем без исключения.

Многие находят чай Кудин весьма интересным, а есть и те, кто пьет его ради поддержания своего здоровья. Вам же мы желаем познать полноту вкуса данного напитка и насладиться им сполна!

Приятного чаепития!

(с) Интернет магазин чая InTea.ru

Следующая статья – Все самое интересное про Белый Пуэр!

]]> ]]>

Китайский чай кудин: полезные свойства, противопоказания и советы врачей

В исторических рукописях китайских династий почти 2000 лет назад присутствует одно из первых упоминаний о чае кудин, его описании и полезных свойствах. В то время он назывался Гаолу и применялся только в лекарственных целях.


Что это такое

Настой изготавливается из побегов падуба – вечнозеленого растения с листьями до 25 сантиметров. Он относится к сильно ферментированным категориям Кху Ча.

Кустарник произрастает в южном и центральном Китае, урожай собирается круглогодично, отличается только ферментация сырья. Молодое состоит из верхних листиков и почек, его вкус более богат и не так горчит, а крупные побеги прессуют или обжаривают, чтобы на более долгий срок сохранить полезные свойства. Собирают, скручивают и сушат его только вручную. Готовое сырье для употребления выглядит как палочки или веретенца 7-8 см в длину.

Химический состав и калорийность китайского чая кудин

Целебные качества объясняются наличием жизненно важных микроэлементов. В их числе белки и аминокислоты, витамины группы В, С, Д, Е, мощные антиоксиданты (фитонутриенты). Он является источником витамина А, поскольку содержит каротин, в его составе присутствует калий, фосфор, цинк, селен, кальций, железо и магний. Падуб содержит никотиновую и аскорбиновую кислоту. Калорийность составляет около 16 кКал.

Отвар восстанавливает нормальное давление, положительно влияет работу сердца, укрепляет и тонизирует сосуды. Выводит не только токсины, но и помогает почкам справляться с продуктами распада белка (мочевиной и креатинином), участвует в регулировании метаболизма.

Полезные свойства горького чая Ку дин


Эту траву в Китае называют лекарством от ста болезней. Китайцы научились сочетать его с другими сортами, усиливать или ослаблять тот или иной эффект, добиваться максимальной пользы от употребления.

Некоторые его особенности:

  • разжижает кровь;
  • восстанавливает жировой и углеводный баланс;
  • действует как противомикробное и противовоспалительное вещество;
  • оказывает мочегонный и жаропонижающий эффект;
  • фосфор в составе благотворно влияет на нервную систему;
  • является мощным противовирусным средством и лекарством от кашля;
  • стимулирует выработку желудочного сока.

Употребление рекомендуется для повышения иммунитета. Стимулируются защитные функции организма, которые помогают быстрее справиться с вирусами и гриппом в осенне-зимний период.

Поскольку он ускоряет метаболизм, выводит токсичные вещества и оказывает мочегонный эффект, он помогает тем, кто борется с лишним весом. Падуб убирает отеки, при этом не допускает обезвоживания.

Он снимает головную боль, улучшает работу памяти и зрение. Даже в зрелом возрасте восстановит четкость мыслей, придаст бодрости, сил и снимет усталость. Имея горьковатый терпкий вкус, отвар повышает настроение и общий тонус. Он содержит больше активных ферментов, чем зеленый чай.

Удивительные качества продукта сочетаются в травяном настое. Природа наделила его способностью оказывать противовоспалительное и антибактериальное действие.

Чем полезен китайский горький зеленый чай Кудин

Одним из компонентов, который лидирует по количеству содержания в падубе, является аскорбиновая кислота. Фармакологические исследования показали, что горечь, которая есть во вкусе, улучшает аппетит и налаживает процессы пищеварения.

Листья растения применяют в виде примочек для глаз, когда работа связана с компьютером. Они помогают снять напряжение и усталость, успокаивают и улучшают глазное кровообращение.

Для взрослых

Китайская горьковатая трава воздействует на гормональный фон, повышая работоспособность и сексуальное влечение. Возбуждающий отвар усиливает мужскую потенцию, женщинам помогает справляться с болями и перепадами настроения в критические дни.

Для пожилых

С возрастом у людей увеличивается риск тромбозов, кровь становится гуще, нарушаются ритмы сердца. Нагрузка на органы повышается, замедляется обмен веществ, ухудшается память и зрения. Появляется лишний вес, одышка и хроническая усталость. Горькая трава приостанавливает процессы старения. Она способна отвратить активное развитие атеросклероза, улучшить настроение, стимулировать активность и жизненный тонус.

Употребление при беременности и кормлении грудью

Вынашивая ребенка, женщина испытывает сильные гормональные перегрузки, ее организм перестраивается и готовится к родам. Обостряются все чувства и реакции. Падуб дополнительно стимулирует нервную систему, поэтому он не рекомендуется для применения в это время. Повышение мышечного тонуса также может сказаться на вынашивании малыша и в период кормления грудью. Кормящим мамам может подойти только в слабо заваренном виде с молоком. Но употребление должно быть целесообразно и необходимо.


Пробовать напиток нельзя, если малышу не исполнилось 3 месяцев. Вводить его в рацион нужно осторожно, начиная с двух-трех глотков в утренние часы. Только понаблюдав днем за поведением и самочувствием ребенка, можно продолжать принимать отвар, но не чаще 1 раза в неделю. Кормящая мама может позволить себе не более 150 мл.

Влияние на детский организм

Врачи придерживаются мнения, что возраст для употребления должен быть не младше 12 лет. Кроме рекомендаций докторов, нужно отметить, что не каждый ребенок сможет выпить этот чай. У него очень специфический вкус, а горький привкус не нравится малышам.

Чтобы укрепить детский иммунитет, поддержать его в период обострения вирусных заболеваний, смягчить воздействие стресса, достаточно половины столовой ложки отвара один раз в день, утром натощак. Если ребенок нормально воспримет напиток, меру можно увеличить до ¼ стакана (50 мл).

Как он помогает избавиться от лишнего веса

Если через полчаса после еды каждый день пить стакан отвара, он поможет снизить вес, стабилизируя липидный обмен. Для пищеварения и помощи при запорах рекомендуется есть только что заваренные листья падуба. У растения есть свойство утолять жажду. А если выпить его вечером, то он поможет снизить аппетит. Известна возможность горькой травы к детоксикации и снятию внутренних отеков, поэтому эстетический эффект при принятии питья обеспечен. Он тонизирует работу желудка, положительно влияет на метаболизм, ускоряя процесс расщепления жиров.

Его мочегонное действие не вызывает обезвоживания, а выведение токсинов помогает от похмелья. Клинически доказано, что достигнуты успехи в лечении алкогольной и никотиновой зависимости при применении этого отвара. Его успешно используют при ожирении и нарушении обмена веществ. С древних времен считается, что он дает не только здоровье и долголетие, но и красоту.

Кудин в народной медицине

Прежде всего листья растения отлично показали себя для лечения кашля и простудных заболеваний. Настой может предупредить образование раковых опухолей, а также помогает организму бороться с воздействием радиации. Одновременно он оказывает влияние на несколько систем, поэтому так активно применяется в китайской медицине.

Как используется в косметологии

Отвар пригоден не только для питья, но и для применения в качестве омолаживающего косметического средства. Свои полезные свойства он сохранит и передаст коже, если протереть лицо и шею кубиком льда.

Для тела подойдет скраб с антицеллюлитным отшелушивающим эффектом. Для этого настой нужно смешать с солью и мягко втирать в проблемные участки кожи.

Процесс приготовления


Первое правило для качественного заваривания – это хорошая вода. Для таких целей не подойдет водопроводная.

Пошаговая инструкция:

  • подогреть воду до 70-80 градусов;
  • ополоснуть посуду горячей водой;
  • положить 1 веретено (или 3-5 грамм россыпью) на стакан объемом 200 мл;
  • сначала сполоснуть траву подогретой до нужной температуры водой, а потом настаивать 15-20 секунд, постепенно увеличивая время в следующие разы.

Этот чай сложный и нестандартный. Если его передержать или не соблюсти пропорцию, он станет невыносимо горьким, а его качества изменятся.

У церемонии есть правила, которые важно соблюдать, чтобы не навредить здоровью:

  • не пить слишком горячий или холодный напиток;
  • избегать крепкого отвара – высокая концентрация тонизирующих веществ негативно скажется на самочувствии;
  • не передерживать заварку, так ухудшаются вкус и полезность продукта;
  • не запивать им лекарства;
  • выливать вчерашнюю заварку, так как в ней нет полезных веществ.

Трава кудин: полезные свойства, вред и противопоказания при заболеваниях

Конечный результат воздействия на состояние человека может быть разный. Это связано с наличием хронических заболеваний, индивидуальной переносимостью и особенностями организма. Настой может как улучшить, так и ухудшить общее самочувствие.


При сахарном диабете

Противопоказаний нет. Листья падуба помогают нормализовать количество сахара в крови. Принимать его можно пациентам без инсулиновой зависимости. Рекомендуемая доза приема – 1 стакан, утром, за 40 минут до еды.

При панкреатите

Напиток оказывает длительное противовоспалительное и успокаивающее действие, способствует восстановлению нормального пищеварения.

При холецистите

Желчегонное действие полифенолов поможет при застое желчи в протоках. Но при обострениях он противопоказан. Воспаление желчного пузыря, как правило, сопровождается желчекаменной болезнью, а растение может спровоцировать болезненное движение камней, стимулируя активность работы органов. Поэтому по поводу его приема нужно посоветоваться с врачом.

Мнение диетологов и врачей о чае Кудин

Специалисты подтверждают богатый спектр полезных компонентов и качеств продукта:

  • он снижает температуру при простуде и гриппе;
  • помогает от боли в горле и кашля;
  • убивает бактерии, оказывает противовоспалительное воздействие;
  • нормализует давление и количество сахара в крови;
  • стабилизирует давление;
  • имеет мочегонное и желчегонное свойство;
  • хорошо влияет на пищеварение и обмен веществ.

Он не должен применяться в качестве основного препарата для лечения. Чтобы получить желаемый эффект, нужно сочетать с рекомендациями врача и образом жизни, который подразумевает:

  • рациональное питание;
  • режим сна и отдыха;
  • занятия спортом и прогулки;
  • позитивный жизненный настрой.

Возможный вред

Горькая слеза при умеренном употреблении и правильном приготовлении принесет пользу. Но в некоторых случаях возможен негативный эффект:

  • беременность и грудное вскармливание;
  • хронический гастрит;
  • проблемы с щитовидной железой;
  • дети до 12 лет;
  • индивидуальная непереносимость и аллергия.

На что ориентироваться при выборе и как хранить

Пить напиток в чистом виде нравится не всем. Однако с сортами можно экспериментировать, миксовать ароматы и вкусы. Горечь зависит от сорта: чем он выше, тем она больше ощущается. Это связано с тем, что состав у них разный. Молодые неогрубевшие листочки не успели напитаться горечью, зато дают небольшую крепость и теряют в насыщенности аромата. Чтобы сохранить сырье, его нужно герметично закрыть и хранить отдельно от ароматных специй, в темном месте.

Советы врачей о пользе и вреде чая кудин

Несмотря на то что при умеренном потреблении и правильном заваривании он не принесет вреда, врачи не рекомендуют включать его в рацион людям с высоким давлением, ограничить питье на период беременности и кормления малыша грудью.


С осторожностью специалисты относятся к тому, чтобы давать листья падуба детям, так как он может вызвать аллергию или расстройство желудка. Больным с проблемами ЖКТ и щитовидной железы он не рекомендуется, хотя и имеет благотворное влияние на пищеварение.

Заключение

Узнав, что такое китайский чай Кудин или «Горькая слеза», его полезные свойства и противопоказания, вы можете самостоятельно оценить необходимость его употребления для себя. Но если вы решите попробовать его, то покупку стоит совершить в проверенном магазине, таком как «Русская Чайная Компания».

Чай кудин для похудения – делюсь опытом

Чай кудин попал ко мне случайно. Но кудин – качественный, из авторитетной пекинской чайной лавки, в герметичной, красивой зелено-золотистой упаковке с китайскими иероглифами, золотым тиснением медалей и наград сорта. 200 грамм плотно скрученных коричнево-зеленых спиралек стоили достаточно дорого – 150 $ (в Китае!).

К тому времени я много чего знала об этом напитке, поэтому заваривала с осторожностью – пол спиральки на 400-граммовую чашку. При температуре воды – около 90°С (короткий период, когда «нити жемчуга» переходят в «шум ветра в соснах»), заваренный, в выбранной мной пропорции, кудин обладал приятной горечью, сладковатым послевкусием и, что сразу обратило на себя внимание, — создавал ощущение сытости. Все, кого я угощала кудином, отмечали эти три особенности кудина.

Но по-настоящему я «подружилась» с этим чаем, когда оказалась на некоторое время одна дома, и мне было лениво ходить за покупками, готовить что-либо, и, вообще, заходить на кухню не хотелось. Пила себе кудин и занималась разными делами. И только на третий день обратила внимание, что я, кажется, ничего не ела. Но есть, при этом, не хотелось, и чувствовала я себя отлично.

Я нигде не нашла противопоказаний к чаю кудин, поэтому, вдобавок к двухразовому питанию, добавила кудин и продолжала, заваривая его не слишком круто, пить целый день. Т.е. половину спиральки заливала горячей водой раз пять-семь в течение дня. Надо отметить, что интенсивность горечи оставалась прежней и своего цвета, раскрывшийся лист кудина, не менял.

Выводы опыта похудения на кудине:

  • Вес на кудине сбросить можно, т.к. кудин настолько богат микроэлементами, витаминами, белками, аминокислотами и пр., что сам по себе представляет полезную и легкую пищу.
  • После чашки кудина остается чувство сытости.
  • Поскольку кудин не пьют с сахаром и сладким, быстро отвыкаешь от лишних углеводов.
  • Длительное употребление кудина позитивно сказывается на самочувствии, стабилизируется ровное состояние работоспособности и активности.
  • Кудин можно использовать и, как средство за ухода за кожей. Последняя заливка – великолепный тоник для лица. Никакой химии. Успокаивает раздражение, стягивает поры, увлажняет, нормализует работу сальных желез.

Я не ставила глобальной задачи – сбросить вес. Но так случилось, что он сам сбросился. Правда, в спортзал я хожу, чистую воду пью, жирное и жаренное не ем уже давно. Теперь еще вот кудин добавился.

Чай Кудин: 10 самых важных фактов

Содержание:

Кудин (ку дин) – это вовсе не чай, хотя Кудин продается практически в любом чайном магазине. В этой статье мы собрали самые интересные факты об этом напитке.

Факт 1. Чай Кудин — не чай в привычном смысле.

Кудин изготавливают из листьев вечнозеленого субтропического растения под названием Падуб широколистный (llex latifolia). Кудин в переводе с китайского означает «горькая трава».

Факт 2. Откуда чай Кудин родом?

Падуб произрастает преимущественно в южных провинциях Китая, на влажных, тенистых склонах гор, а также в смешанных лесах по берегам рек. Это невысокое, крепкое деревце с толстыми гладкими ветвями и крупными зелёными листьями с глянцеватым блеском. Цветы падуба мелкие, желтоватые. Они образуются в пазухах листьев весной. Ягоды Падуба небольшие, круглые, желтого, оранжевого или красного цвета, созревают осенью и могут сохраняться на дереве всю зиму.

Факт 3. Как использовали Падуб?

Падуб издавна ценился за декоративные и целебные качества. Им украшали дома в Древнем Риме в дохристианскую эпоху, а впоследствии падуб (или остролист) стал, наравне с омелой, символом Рождества. Друиды считали падуб символом солнца, а североамериканские индейцы готовили противоядия из листьев и черенков падуба чайного (Ilex vomitoria).

Факт 4. А как насчет напитка Матэ?

Сырьем для небезызвестного напитка матэ также служит один из видов падуба – падуб парагвайский (Ilex paraguariensis). Матэ готовят из высушенных, измельченных листьев и молодых побегов.

Факт 5. Полезные свойства чая кудин.

История применения кудина как лекарства в Китае насчитывает не одно столетие. Кудин (или кхудин) китайцы относят к горьким чаям, кху ча. Горький вкус в традиционной китайской медицине соотносится с энергией инь, огнем, сердцем и тонким кишечником. Считается, что горький вкус устраняет излишний жар и огонь, применяется для лечения кашля и одышки, при заболеваниях желудка и кишечника, сопровождающихся тошнотой, рвотой и запорами. Также горечь способствует устранению застоя энергии (ци) в организме.

Проще говоря, чай ку дин обладает общеукрепляющим, тонизирующим, жаропонижающим, противовоспалительным, детоксикационным, диуретическим действием. Кроме того, кудин нормализует артериальное давление, углеводный и липидный обмен и способствует похудению, а еще обладает противоопухолевым эффектом.

Факт 6. Собирают кудин только вручную, небольшими партиями, весной. Затем сырье скручивают, прокаливают и сушат на солнце.

Факт 7. Кудин бывает скрученный, спиральный, связанный, листовой и даже прессованный.

Факт 8. Высший сорт чай кудин – Кудин Шуй Сю

производится из мелких молодых листочков, собранных на Желтой горе (Хуан шань) в провинции Сычуань. Этот сорт поставляли к императорскому двору.

Факт 9. Как пить и как заваривать чай Кудин?

Кудин – отличное профилактическое средство, однако пить часто его не стоит, достаточно заваривать 2-3 раза в неделю, но заваривать правильно, чтобы не получить напиток полынной горечи.

Температура воды – 80 градусов, лучше всего заваривать чай ку дин проливом, 1-2 иголочки на гайвань или чайничек. Первую заварку сливать не обязательно, но желательно, настаивать несколько секунд, увеличивая время по мере остывания воды. 

Кудин также можно заваривать в большом чайнике (3-4 иголочки) или в кружке (достаточно 1 иголочки). 

Главное – соблюсти температурный режим и не передержать заварку. 

Цвет готового настоя кудина желтовато-зеленый, аромат тонкий и благородный, во вкусе присутствует горечь и некоторая терпкость, послевкусие неизменно сладкое. Выдерживает многократное заваривание.

Факт 10. К сожалению, чай кудин частенько становится жертвой предубеждения.

Многие, неправильно заварив кудин при первом знакомстве, не желают это знакомство продолжать, а зря: кудин – отличный помощник в борьбе с целым спектром заболеваний, он наполняет тело легкостью, а сознание – ясностью. А еще кудин хорош в качестве добавки к шу пуэру.

как заваривать, польза и вред

С китайского название «кудин» так и переводится — «горькие гвозди». Неудивительно, ведь горечь – первый вкус, который мы чувствуем, когда делаем глоток этого чая. Не всякий сумеет распробовать кудин с первой (и даже с десятой) попытки. Несмотря на это, он считается одним из самых ценных напитков, дарующих крепкое здоровье и долголетие.

Помимо сильной иммуномодулирующей функции, кудин обладает поистине императорским набором полезных свойств

Говорят, что знаменитый китайский чай кудин стал таким, каким мы его знаем, в связи с трагической историей, детали которой давно уже стерлись в веках. Но если в двух словах, то это была история прекрасной девушки, что жила в провинции и собирала листья падуба для чая. Ее красота привлекла внимание местного чиновника, решившего, что девушка станет отличным подарком императору, и сборщица чая оказалась обречена на судьбу наложницы. Не желая мириться с этим, девушка сбросилась со скалы в том самом месте, где обычно собирала листья. Говорят, капли ее крови попали на кусты падуба и окрасили его почки в яркий красный цвет, а самим листьям подарили тот особенный горький вкус, который известен нам сегодня.

Падуб широколистный. Источник: greeninfo.ru

Что такое кудин?

Многие полагают, что кудин – один из сортов китайского чая, но это не так.

Практически весь китайский чай производится из листьев и/или почек растения камелия синенсис путем их ферментации. Кудин же представляет собой напиток из листьев падуба широколистного. Его парагвайский родственник служит основой для чая мате. Только у мате вкус нежный и сладковатый, а кудин известен своей яркой горечью.

Собирают листья падуба широколистного на склонах гор и в лесах китайских провинций Фуцзянь, Юньнань, Хэнань и Сычуань. А продается этот растительный чай чаще всего в виде тонких скрученных вручную «гвоздиков», реже бывает в спиралях, связанном, а также в рассыпном виде.

Несмотря на то, что кудин не является чаем в классическом понимании этого слова, он, как и листья камелии синенсис, содержит кофеин. Это важно помнить, поскольку обычно травяные чаи не имеют кофеина в своем составе, и их можно пить в любое время дня. С кудином все немножко иначе – он способен «зарядить» не хуже кофе, а потому с ним стоит быть осторожней.

Поклонники кудина сравнивают его вкус с грейпфрутом

Наш эксперт-титестер Наталья Прохоренко сравнивает вкус кудина со вкусом грейпфрута:

Сначала ты ощущаешь только горечь, но в послевкусии оказывается гораздо больше интересных оттенков, включая нежную тонкую сладость.

Как заваривать кудин и когда лучше пить?

Напиток допускает разные варианты приготовления, не утрачивая своих полезных свойств, но оптимальным считается заваривание по принципу зеленого чая: промытые кипятком листья (1 ч.л./1 «гвоздик» на 200-250 мл) следует залить водой около 80-85 градусов и настаивать не более 3 минут. Первую заварку лучше держать не дольше 1 минуты, затем увеличивать временной интервал. При таком подходе чай получается более нежным и менее горьким. Многие любители кудина утверждают, что самое трудное – поймать тот момент, когда полезные свойства листа уже перешли в настой, а сильная горечь – еще нет. Мы рекомендуем начинать с нескольких секунд (10-20), постепенно позволяя чаю настаиваться подольше.

Листья кудина выдерживают до 5 заварок. Не рекомендуется запивать этим напитком еду.

Наш эксперт советует употреблять кудин в чистом виде только в том случае, когда вам нужна «скорая медицинская помощь» – например, в начале простуды или при высокой температуре.

Когда я чувствую, что заболеваю или уже заболела, я завариваю кудин. Эффект, конечно, отличается от того, который дают антибиотики или жаропонижающее (когда выпил – и сразу хорошо), но в целом, если организм приучить к такому лечению, оно отлично действует. Однако с обычными лекарствами кудин стоит сочетать с осторожностью.

Если же у вас нет необходимости разом получить большую порцию полезных веществ, которые содержатся в этом напитке, лучше просто добавлять «гвоздики» кудина к другим чаям, в идеале – к пуэру.

Кстати еще одна легенда про кудин гласит, что рецепт этого напитка другой китайский император подарил своей возлюбленной в качестве эликсира молодости и здоровья. И отличный подарок ведь!

Интересное сочетание: пуэр и палочка кудина

Польза и вред чая кудин

Помимо сильной иммуномодулирующей функции, кудин действительно обладает поистине императорским набором полезных свойств. В том числе он:

  • Повышает жизненный тонус
  • Предотвращает образование тромбов и разжижает кровь
  • Действует как противовоспалительное и обеззараживающее средство
  • Имеет жаропонижающее действие
  • Используется для лечения кашля и катара верхних дыхательных путей
  • Улучшает пищеварению, уменьшает газообразование
  • Стимулирует работу сердечно сосудистой системы и укрепляет стенки сосудов
  • Имеет мочегонное действие
  • Нормализует давление и уровень сахара в крови
  • Выводит шлаки и токсины, очищает печень, сжигает жиры, способствует снижению веса
  • Улучшает память

Не рекомендован кудин беременным и кормящим женщинам (по той же причине, что крепкий чай или кофе), а также детям до 12 лет.

Чай (Кудин) Чайна Країна Копья Ку Дин 100г

Уникальный китайский элитный зелёный чай, изготовленный по наидревнейшей технологии. Скрученный вручную чайный лист, имеет форму копья. Содержит большое количество витаминов и аминокислот.

 

Полезные свойства:

 

Он содержит большое количество витаминов и аминокислот и обладает множеством целебных свойств. Чай Ку Дин бодрит и тонизирует, повышает имуннитет, останавливает кашель во время простуды, снижает артериальное давление, улучшает пищеварение, снижает уровень сахара в крови, а также он является сильным антиоксидантом и защищает организм от воздействия радиации.

В нашей стране Кудин набирает популярности из-за его невероятной эффективности при похудении.

Как правильно заваривать Ку Дин:

Заваривают его точно также, как и зеленый чай. Единственное нужно знать, что температура воды влияет на вкусовые особенности. Если залить кипятком, то получится сильная горкьковатость, а если водой температурой 50 °C, то получится более благородный напиток с минимальной горечью. Первую заварку необязательно сливать, но желательно.

Пробуйте для себя что-то новое и приятного чаепития!

 

Чай
Популярные чаи Ку Дин (Кудин)
Сорт чая Зеленый чай
Вес чая, г 100
Упаковка чая Пакет из фольги
Добавки Без добавок
Производитель чая Чайна Країна
Категория листа Листовой
Фасовка чая Рассыпной

Написать отзыв

Ваш отзыв:

Внимание: HTML не поддерживается! Используйте обычный текст.

Чай Кудин: 10 самых важных фактов

Чай кудин. Все о чае Кудин здесь. 

Какие полезные свойства у чая кудин?

Где купить кудин?

Как заваривать кудин?

Стоит ли пить кудин для похудения?

Горький ли чай кудин?

Как пить кудин?

Кудин (ку дин) – это вовсе не чай, хотя его можно найти практически в любом чайном магазине. Здесь мы собрали самые интересные факты об этом напитке. Теперь Вам не надо собирать информацию кусочками по интернету. Все здесь!

1.Производится кудин из листьев вечнозеленого субтропического растения под названием Падуб широколистный (llex latifolia). В китайском словаре падуб значится: ???, k?d?ngch?. Кудин в переводе с китайского означает «горькая трава».

2.Падуб произрастает преимущественно в южных провинциях Китая, на влажных, тенистых склонах гор, а также в смешанных лесах по берегам рек. Это невысокое, крепкое деревце с толстыми гладкими ветвями и крупными зелёными листьями с глянцеватым блеском. Цветы падуба мелкие, желтоватые, образуются в пазухах листьев весной, ягоды небольшие, круглые, желтого, оранжевого или красного цвета, созревают осенью и могут сохраняться на дереве всю зиму.

3.Падуб издавна ценился за свои декоративные и целебные качества. Им украшали дома в Древнем Риме в дохристианскую эпоху, а впоследствии падуб (или остролист) стал, наравне с омелой, символом Рождества. Друиды считали падуб символом солнца, а североамериканские индейцы готовили противоядия из листьев и черенков падуба чайного (Ilex vomitoria).

4.Сырьем для небезызвестного напитка матэ также служит один из видов падуба – падуб парагвайский (Ilex paraguariensis). Матэ готовят из его высушенных, измельченных листьев и молодых побегов.

5. Полезные свойства чая кудин. История применения кудина как лекарства в Китае насчитывает не одно столетие.

Кудин (или кхудин) китайцы относят к горьким чаям, кху ча. Горький вкус в традиционной китайской медицине соотносится с энергией инь, огнем, сердцем и тонким кишечником. Считается, что горький вкус устраняет излишний жар и огонь, применяется для лечения кашля и одышки, при заболеваниях желудка и кишечника, сопровождающихся тошнотой, рвотой и запорами. Также горечь способствует устранению застоя энергии (ци) в организме.

Проще говоря, чай ку дин обладает общеукрепляющим, тонизирующим, жаропонижающим, противовоспалительным, детоксикационным, диуретическим действием. Кроме того, кудин нормализует артериальное давление, углеводный и липидный обмен и способствует похудению, а еще обладает противоопухолевым эффектом.

6.Собирают кудин только вручную, небольшими партиями, весной. Затем сырье скручивают, прокаливают и сушат на солнце.

7.Кудин бывает скрученный, спиральный, связанный, листовой и даже прессованный.

8.Высший сорт чай кудин – Кудин Шуй Сю – производится из мелких молодых листочков, собранных на Желтой горе (Хуан шань) в провинции Сычуань. Именно его поставляли к императорскому двору.

9. Как пить и как заваривать чай Кудин? Кудин – отличное профилактическое средство, однако пить часто его не стоит, достаточно заваривать 2-3 раза в неделю, но заваривать правильно, чтобы не получить напиток полынной горечи.

Оптимальная температура воды – 80 градусов, лучше всего заваривать чай ку дин проливом, 1-2 иголочки на гайвань или чайничек. Первую заварку сливать не обязательно, но желательно, настаивать несколько секунд, увеличивая время по мере остывания воды. Кудин также можно заваривать в большом чайнике (3-4 иголочки) или просто в кружке (достаточно 1 иголочки). Главное – соблюсти температурный режим и не передержать заварку. Цвет готового настоя кудина желтовато-зеленый, аромат тонкий и благородный, во вкусе присутствует горечь и некоторая терпкость, послевкусие неизменно сладкое. Выдерживает многократное заваривание.

Получить подробную инструкцию с фотографиями

10. К сожалению, чай кудин частенько становится жертвой предубеждения. Многие, неправильно заварив его при первом знакомстве, более не желают это знакомство продолжать, а зря: кудин – отличный помощник в борьбе с целым спектром заболеваний, он наполняет тело легкостью, а сознание – ясностью. А еще кудин хорош в качестве добавки к шу пуэру.

 

 

Needle Kuding Tea — Ku Ding Cha — Kuding plus Tea

Посмотрите видео ниже, в котором мы завариваем 3 иглы внутри заварочного устройства. Это слишком просто, но это правда.

Чай Кудин (также известный как «Ку Дин Ча») — это лечебный чай, который тысячелетиями использовался в традиционной китайской медицине. Слово «Ку» означает горький, а китайский иероглиф «Дин» («丁») означает «шип», как и форма этого чая. Игольчатый чай кудинг широко известен как «чай с горькими гвоздями».Для приготовления этого чая используются листья вечнозеленого растения Ilex Kuding cha, которое выращивают в Китае. Длинные узкие листья скручены вместе, образуя характерные длинные палочки / шипы. Еще одна отличительная черта, как следует из названия, — горький вкус. Однако некоторые пьющие считают, что за горечью следует слегка сладковатый привкус.

При приготовлении чая Кудинг рекомендуется использовать всего 2 иглы / иглы, если вы впервые попробовали чай из-за его сильного горького вкуса.По мере того, как вы привыкаете к чаю, вы можете увеличить его количество до 3-4 игл. Начните с того, что согрейте чайную чашку и чайник горячей водой. Затем настаивайте чай Кудинг в кастрюле горячей водой в течение двух минут. Шипы можно использовать несколько раз — после второго заваривания нужно будет увеличить время заваривания.

В традиционной китайской медицине чай Кудин был известен своим разнообразием применения и до сих пор популярен при таких заболеваниях, как улучшение памяти и сосредоточение внимания; успокаивающая суетливость; облегчает простуду, помогает при очистке головы и ринита; зуд в глазах; головные боли; облегчение синусита; и лечение бронхита.Также говорят, что он улучшает пищеварение; снизить артериальное давление и снизить уровень холестерина. Чай Кудинг содержит много антиоксидантов, поэтому полезен для детоксикации.

Не пейте чай Кудинг во время беременности, если вы недавно родили или кормите грудью; во время менструации; у вас низкое артериальное давление. Также не пейте 1 месяц до и после операции. В прошлом мы часто получали вопросы относительно чая Кудин и плодородия. Из-за сложности этой темы сложно дать общий ответ.Проконсультируйтесь с местным практикующим врачом или врачом китайской медицины.

Дополнительную информацию о здоровье можно найти здесь: Польза и побочные эффекты Kuding для здоровья

Чай Кудинг Цена

Вы могли заметить, что кудинг иногда может быть немного дороже. И из-за этого вы можете задаться вопросом, почему это растение так доступно в Teasenz. Поскольку мы находимся в Китае, наши эксперты по травам напрямую работают с поставщиками качественных продуктов. Это позволяет нам вырезать для вас несколько посредников.Более того, вы не будете наслаждаться самой низкой ценой на чай Кудинг, но также насладитесь этой травой как можно более свежей.

Связанные поисковые запросы: китайский кундин, чай кун дин, чай ваньчэн кудинг, чай кудинг плюс

Руководство по преимуществам чая Кудин (обновлено за 2019 год)

Кудинг — это сорт растения, произрастающий в Китае. Согласно историческим документам, это растение применялось как лечебное растение более 2000 лет. Во времена династии Сун его преподносили правительственным чиновникам как дань уважения.Позже производство чая Кудинг (или Кудинг ча) увеличилось, и он стал популярной народной медициной. Чай также часто называют иглой кудинг, поскольку плоские листья часто скручиваются в игольчатые формы.

Чай Кудин и китайская медицина

Учитывая богатую историю этого растения, мы изучили пользу кудинга для здоровья. Практикующие врачи могут применять это растение при соблюдении следующих условий:

  • Избыточный нагрев
  • Головная боль
  • Красные глаза
  • Зубная боль
  • Тиннитус (звон в ушах)
  • Диарея
  • Головокружение
  • Угри

Кудинг Ча и народная медицина

Однако, когда врачи прописывают кудинг, он часто бывает в более концентрированной форме, например, в порошке.Если используются настоящие травы, обычно пациенту рекомендуют варить их в горячей воде в течение нескольких часов. В результате получается высококонцентрированный лечебный напиток, который обычно имеет очень горький вкус.

Хотите попробовать чай Кудинг? Затем купите чай Kuding в Интернете. На этой странице также есть видео, демонстрирующее, как его можно приготовить в заварочном устройстве для чая.

В немедицинском мире кудинг часто употребляют в качестве чая в Китае. Таким образом, эффект намного слабее, и поэтому он считается безопасным для длительного употребления без консультации с врачом.Кроме того, послевкусие более приятное и часто описывается как слегка сладкое и освежающее. Ниже также представлены некоторые другие китайские травяные чаи, которые доступны в нашем интернет-магазине:

Исследование преимуществ чая Kuding

Кожа и старение

В недавнем исследовании, опубликованном в 2019 году (Molecules), ученые пришли к выводу, что полифенолы в Кудинге могут защищать клетки кожи, коллаген и эластин, тем самым предотвращая повреждение кожи у мышей.

Похудание

В исследовании, опубликованном в 2017 году (Nature International Journal of Science), исследователи обнаружили, что кудинг подавлял прибавку в весе у мышей по сравнению с мышами, которых не лечили.Это говорит о том, что кудинг может входить в состав лекарств от ожирения. Авторы считают, что этот эффект является результатом не изменения аппетита, а увеличения расхода энергии, что должно стать предметом дальнейших исследований.

Исследование, проведенное в 2018 году в Эльзевире, также утверждает, что экстракт этанола в Кудинге может уменьшить ожирение и высокий уровень холестерина.

Чай и печень Kuding

В 2017 году исследование, опубликованное в журнале Food & Function Journal, показало, что полисахариды чая Кудинг могут быть полезны для печени.В этом исследовании мыши с высоким содержанием фруктозы вызывали повреждение печени. Когда мышей также кормили кудингом, это показало, что он может облегчить повреждение печени и дисфункцию эндотелия сосудов.

Чай Кудинг и язва

В исследовании 2018 года, опубликованном в журнале Food & Function Journal, у мышей было вызвано повреждение желудка. После лечения мышей полифенолами чая кудинг исследование показало, что кудинг оказывает профилактическое действие при травмах желудка.

Диабет, холестерин и артериальное давление

Чай Кудинг содержит полезные компоненты, включая аминокислоты, полифенолы, флавоноиды, цинк и несколько витаминов.Как народная медицина кудинг ча известна по следующей поговорке «降 三 高» (цзян сан гао), что буквально означает «снизь до трех». Это относится к тому факту, что эта трава может помочь снизить высокий уровень сахара в крови (диабет), высокое кровяное давление и высокий уровень холестерина.

Угри и неприятный запах изо рта

Кроме того, антибактериальные свойства кудинга делают его популярным и эффективным средством от прыщей и неприятного запаха изо рта.

Плодородие

Эта трава иногда может также помочь улучшить фертильность, но это будет зависеть от индивидуальных условий.Здесь мы можем сделать общие заявления. По этому поводу вам следует проконсультироваться с местным врачом китайской медицины.

Сколько и когда пить чай Кудинг?

Правильное количество Кудинга, подходящее для вас, действительно дайверы, на человека. Обычно люди начинают с замачивания 2-3 игл Кудинг в горячей воде каждое утро и день. Листья можно снова заварить и употреблять, пока не перестанет аромат. Если у вас нет подходящих инструментов, например кружки для заварки, чай может стать горьким.Просто добавьте еще воды, чтобы уменьшить горечь.

Как только некоторые симптомы уменьшатся, можно уменьшить потребление, приготовив кудинг-ча только один раз в день (утром или днем) в профилактических целях.

Побочные эффекты чая Kuding

Этот травяной напиток является эффективным китайским лекарством и в чистом виде обычно считается безопасным, но следует учитывать несколько побочных эффектов чая кудинг:

Беременность

Поскольку кудинг — охлаждающая трава, его следует избегать во время беременности и в период кормления грудью.

Кофеин

Этой травы следует избегать, если вы очень чувствительны к кофеину (хотя она содержит кофеин в минимальных количествах, что даже меньше, чем в обычном чае).

Другое

  • следует избегать людям, страдающим пониженным давлением.
  • следует избегать за 1 месяц до и после операции.
  • Вышеупомянутое, в основном, относится к чистой ку-динг-ча. На рынке есть некоторые продукты кудинга, смешанные с другими ингредиентами.Для этого вам нужно внимательно прочитать упаковку.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение является мировой проблемой, и его распространенность быстро растет [1]. Ожирение вызывается накоплением лишних калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4].Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат (орлистат), одобренный FDA для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Х-рецепторы печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина.Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при питании с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей, устойчивых к инсулину, за счет регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9].Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей. С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае в качестве напитка более 2000 лет. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью высокоэффективной жидкостной хроматографии с обращенной фазой (ОФ-ВЭЖХ)

Для анализа профилей отпечатков пальцев ЭК (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение выполняли на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Культура клеток

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем среду для дифференцировки (DM), содержащую 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Штат Миссури), и к культуре добавляли 0,8 мМ изобутилметилксантин (IBMX, Sigma, Сент-Луис, штат Миссури). Через 4 дня среду заменяли на DMEM с 10% фетальной бычьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Gene Прямой праймер Обратный праймер
β-Актин TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17].Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда плазмиды экспрессии котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина.Все эксперименты по трансфекции независимо проводили трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом разделили на разные группы и затем поместили на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK, или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (ТГ), общего холестерина (TC), холестерина ЛПВП (HDL-c) и холестерина LDL (LDL-c) определяли с помощью автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) с 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на срез 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела).Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (рисунок S1D) идентичен лупеолу (рисунок S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля для транспортных средств. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): ЭК использовалась только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты RT-PCR в реальном времени уровней экспрессии гена в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * P <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Далее мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): Увеличение массы тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * P <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.1, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK.Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее значение ± стандартная ошибка среднего. N = 7 для всех групп. * P <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли через равные промежутки времени в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни ОХ, ЛПНП или ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты ОТ-ПЦР в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля для транспортных средств. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют как минимум три независимых эксперимента, а данные представлены как средние значения ± стандартная ошибка среднего.* P <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, получавших EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * P <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27].Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также ингибировались в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы представляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке крови у пациентов с дислипидемией [29], [30] и улучшает артериальное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи.Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что пониженные уровни липидов и масса тела не могут быть связаны со сниженным всасыванием липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ в сыворотке и уровни глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется на экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно подавляется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные позволяют предположить, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Чай Кудинг (One Leaf Tea)

Кудинг из Китая

Несмотря на то, что сегодня он называется Чай Кудинг , на самом деле это не чай, потому что он исходит не из чайного куста, а из листья одного из видов падуба широколистного. Kuding собирают в основном в южных регионах Китая: на склонах, в каньонах и поясах.

Внешний вид сухого чая не слишком привлекателен: темные листья, скрученные в трубочку и немного сморщенные. Но пусть это вас не беспокоит! Этот факт свидетельствует о том, что листья были собраны вовремя, высушены и хранились с соблюдением всех технологий. Но его потрясающий специфический аромат ощущается сквозь закрытую упаковку.

Польза чая Кудинг для здоровья

Ученые всего мира тщательно изучили свойства чая Однолистовой и пришли к следующим выводам:

  • Напиток может быть использован в качестве профилактического средства при начинающейся гипертонии;
  • Если человек страдает кишечными коликами, регулярное употребление этого чая избавляет от них;
  • Это мощное средство от кашля, избавляет от жара и снимает озноб;
  • Действует как тонизирующее и тонизирующее средство;
  • Удаляет холестерин из крови;
  • Очищает печень, выводит токсины и шлаки.

Кроме того, Кудинг разжижает кровь, что помогает предотвратить образование тромбов. Если выпивать чашку этого напитка каждое утро, то он укрепит сердечно-сосудистую систему, избавит от головных болей и хронической усталости.

Он был изучен и имеет химический состав чайного напитка — такого богатого количества минеральных элементов и витаминов не обнаружено ни в одном другом растении. Судите: натрий , магний, калий, фосфор, витамины A, C, D, E, и целая линейка витаминов ฺ B … Неудивительно, что Кудинг рекомендуется пить людям с ожирением, повышенным артериальным давлением, пониженным иммунитетом и хроническими воспалительными заболеваниями. Есть и противопоказание — этот чай нельзя пить людям с хроническим гастроэнтеритом.

Оптовые заказы

Если у вас есть собственный магазин чая, СПА или любой другой бизнес, где вы подаете чай, напишите нам. Мы постараемся предложить интересную цену на оптовый заказ чая Кудинг. Наш адрес электронной почты — tea-village @ hotmail.com.

Norland Kuding Tea / Norland Products

Взгляды: 434

Чай Norland Kuding — это 100% органический чай, который снижает высокий уровень холестерина, высокое кровяное давление и высокий уровень сахара. Это единственный чай, который держит вас в тонусе и сохраняет сияние кожи.

Что такое Кудинг?

Кудинг — растение, произрастающее в Китае. Исторические документы содержат информацию о том, что кудинг как лекарственное растение использовалось китайцами более 2000 лет.Однако только во времена династии Сун кудинг был представлен как чай. Правительственные чиновники и высшее общество династии Сун были первыми, кто попробовал чай кудинг.

Современные клинические исследования показывают, что чай Norland Kuding обладает следующими свойствами:
  • Отводит тепло
  • Удаляет токсины
  • Снимает воспаление
  • Убивает бактерии
  • Прекращает кашель
  • Удаляет мокроту
  • Способствует пищеварению
  • Освежает разум
  • Предотвращает рак
  • Снижает артериальное давление
  • Снижает уровень холестерина в крови.

Чай Кудинг также может облегчить
— головную боль из-за его охлаждающих свойств
— красные глаза
— зубная боль
— чрезмерное тепло
— неприятное дыхание
— угри и головокружение

Некоторые ингредиенты чая Norland Kuding

Темный чай

Он может значительно помочь в выработке антиоксидантов, снизить кровяное давление, снизить жирность крови, контролировать уровень сахара в крови и т. Д. Он помогает с мочегонной детоксикацией, противорадиационным действием и уменьшает воспаление.

Лист лотоса

Он уменьшает сердечный огонь, огонь селезенки и огонь легких, очищает жар и освежает разум, снижает кровяное давление и способствует диурезу.

Преимущества чая Norland Kuding
  • Похудение и похудение
  • Регулировка трех гипергликемии: гипертоническая болезнь, гиперлипидема и гипергликемия
  • Координация кишечника и желудка
  • Обновление ума
  • Профилактика рака
  • Продление жизни

Norland Kuding Tea Осторожно
  • Людям, страдающим пониженным давлением, следует избегать чая Кудинг
  • Не принимайте чай Кудинг за 1 месяц до и после операции.
  • Вышеупомянутое, в основном, относится к чистой ку-динг-ча. Чайные продукты Norland kuding смешиваются с другими ингредиентами. Внимательно прочтите упаковку.

Травяной чай Ку Дин — JADEsCHA

Этот чай Кудинг с небольшими листьями — это свежий китайский настой с горькой свежестью, но в конце он слегка сладковат. Его часто пьют в центре и на востоке Китая, так как чай оказывает несколько полезных лечебных эффектов, особенно помогает похудеть.Он также содержит меньше кофеина, чем зеленый чай. При заваривании его лист меняет свой внешний вид всего за несколько секунд, что удивительно.

Чай Кудинг Обычно для приготовления чая кудинг используются два наиболее распространенных растения, одно из которых обычно выращивают в провинциях Сычуань, Юньнань, Гуйчжоу и Чжэцзян и по форме напоминают зеленый чай. В то время как другой вид растений часто встречается на Хайнане и в провинции Гуанси, на юге Китая, он имеет форму длинной скрученной формы.

Традиционные китайские лечебные свойства, связанные с кудингом (и многими другими растениями), включают его способность рассеивать тепло ветра, очищать голову и глаза и выводить токсины, поэтому он используется при простуде, рините, зуде в глазах, красных глазах, и головная боль.Также говорят, что он успокаивает непоседы и облегчает жажду, особенно когда кто-то страдает заболеванием, вызывающим лихорадку или сильную диарею. Он трансформирует мокроту и облегчает кашель, поэтому используется при лечении бронхита. Наконец, говорят, что он улучшает пищеварение и улучшает умственную концентрацию и память.

Некоторые исследования могут предполагать, что это растение, полученное из Ilex или Ligustrum , улучшает кровообращение, снижает кровяное давление и снижает уровень липидов в крови, включая холестерин.Он имеет репутацию средства предотвращения ухудшения работы сердца и мозга и поддержания надлежащего веса тела. Также было обнаружено, что кудинг, приготовленный из L. robustum , помимо дополнительных противовоспалительных свойств обладает такими же антиоксидантными эффектами, как и чай.

Как приготовить:

1-3 минуты
95-100 ° С
3-5 граммов / 1 столовая ложка

Kuding-Bitter Nail Tea, Twist Shape Tea от ESGREEN — Steepster

Kuding cha, чай Ku Ding, также известный как «горький чай»
Китайское название: 苦丁茶 (kǔdīng chá) буквально «чай с горьким гвоздем / шипом»

Чай Кудинг имеет особый горький вкус, который иногда трудно принять новым ценителям.Но чем больше вы выпьете, тем больше сможете оценить сладкий вкус, сопровождаемый горечью.

На китайском языке «ку» означает горький, описывающий вкус, а «дин» означает гвоздь или небольшой кусочек, указывающий на форму чайных листьев. Чай Кудинг — это уникальный китайский чай. Он не подпадает ни под одну из категорий зеленого, черного, улун или белого чая, которые производятся из листьев Camellia Sinensis. Чай Кудинг изготавливается из листьев широколиственного падуба, принадлежащего к семейству Folium Llicis Latifoliae.В основном он производится в провинциях Юньнань, Хайнань и Фуцзянь, Китай.
Одно время чай Ку Дин использовался только как подношение королевской семье. В китайской медицине этот редкий и дорогой чай чрезвычайно эффективен для снижения уровня холестерина и высокого кровяного давления. Исследователь обнаружил, что у людей, которые пили этот чай ежедневно, меньше шансов получить инсульт или сердечный приступ.

Польза для здоровья

Чай Кудинг имеет репутацию «чая здоровья», «чая долголетия» и «чая для похудания».Было доказано, что чай кудинг может уменьшить воспаление и облегчить боль, улучшить здоровье и очистить от токсинов, уменьшить жир и кровяное давление, а также поддерживать форму. Чай Кудинг широко используется для лечения простуды, ринита, зуда в глазах, красных глаз, парения горла и головной боли. Чай Кудинг очень эффективен для похудания. Медицинские исследования показывают, что чай Кудинг содержит много важных и терапевтических биоактивных химических веществ: 22 Глицин Кудинг, 1,4 аминофенола, 8,8 полифенолов, 41 витамин С, 1,2 флавоноидов и т. Д.
Чай Кудинг оказался очень ценным напитком для здоровья, обладающим терапевтическими способностями охлаждения, очищения, алексифармического, антибактериального действия, снижением кровяного давления, улучшением пищеварения и защитой от рака среди практикующих врачей на протяжении всей истории.

Традиционные китайские лечебные свойства, связанные с ку Дином (и многими другими растениями), включают его способность рассеивать тепло ветра, очищать голову и глаза и выводить токсины, поэтому он используется при простуде, рините, зуде в глазах, красных глазах. , и головная боль.Также говорят, что он успокаивает непоседы и облегчает жажду, особенно когда кто-то страдает заболеванием, вызывающим лихорадку или сильную диарею.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *