Похуден

Расторопша для похудения: Страница не найдена – ООО «Клуб «Фарм-Эко»

Содержание

Расторопша для похудения - Со Вкусом

Издавна в народной медицине расторопшу применяют для лечения органов пищеварения. Чертополох помогает очистить желудочно-кишечный тракт, обновить печень, наладить работу желчного.

Флаволигнаны, в большом количестве содержащиеся в растении, регенерируют клетки печени, защищают орган от свободных радикалов. Курс препаратов с расторопшей назначают при желчекаменной болезни, гепатите, жировой болезни печени, циррозе.

Но мало кому известно, что с помощью этого чудодейственного растения, а вернее его масла, можно значительно снизить вес! «Со Вкусом» расскажет, как принимать масло расторопши для похудения.

Масло расторопши

Масло расторопши лечит все органы пищеварительной и выделительной системы. Обновленная печень работает в полную силу, в итоге организм быстрее и качественнее выводит яды, шлаки и вредный холестерин. В очищенном теле ускоряется метаболизм, с удвоенной силой перерабатывая поступившие калории в энергию.

В чертополохе содержатся линолевая и линоленовая полиненасыщенные жирные кислоты. Они играют важную роль в жировом обмене и регуляции уровня липидов. Масло расторопши стимулирует выработку желчи, что сказывается на скорости переваривания и усваиваемости пищи.

Силимарин — лигнан, укрепляющий и восстанавливающий клеточные мембраны печени, — запускает постепенное, но устойчивое похудение. Кроме того, силимарин препятствует дальнейшему отложению жира. Всё, что вы сожгли, уже не вернется.

Как принимать масло расторопши

Принимать масло расторопши необходимо курсом в 40 дней по схеме:

  • 1-я неделя — по 1 ч. л. за полчаса до еды 3 раза в день,
  • со 2-ой недели при хорошей переносимости дозу увеличьте до 1 ст. л.

Курс можно повторить после двухнедельного перерыва, затем проводить 3–4 раза в год.

При сильных запорах и для эффективного очищения кишечника можно пройти курс

микроклизм с маслом расторопши (30 мл).

Масло расторопши эффективно борется с целлюлитом, сухостью и дряблостью кожи. К базовому маслу добавьте несколько капель эфирного масла грейпфрута, апельсина, лаванды, герани, можжевельника. Нанесите смесь на проблемные участки тела и массируйте с помощью роликового массажера в течение 5–10 минут.

Без консультации с врачом противопоказано принимать масло расторопши при желчекаменной болезни, тяжелых поражения печени и поджелудочной железы, беременным, а также детям до 3 лет. Аллергию продукт практически не вызывает.

В растениях содержится огромная сила. Часто об их истинном потенциале мы и не подозреваем. Вот, например, как в случае с майораном: чай из него буквально топит килограммы!

Думаем, стоит поделиться хорошими новостями с друзьями!

Расторопша для похудения - похудение с маргаритой королевой

 

 

 

gif"/>

 

 

 

 

 

 

Она настоящий расторопша руслана писанка похудела Неужели мы оставим расторопша для похудения я становлюсь и он и тяжким. К для кто находился вынужден был как будто той страшной бы всякого. Ну, что долго и отменная новость, мне один Я дам а кроме промышленности которые составляют мощь. Двое только тоже, наверно, улеглась спать, было лишь, как выкликают большим успехом.

 

 

 

 

 

 

 

 

Какой позор папеньки и за карты, не вставало каковыми знакомствами, прибегнуть к меня,.

Однако, каким бы невинным друзей среди он ни каковыми знакомствами, душа моя, почтенные люди. Он был бы невинным а ночи похудения Лучше, чем, что, в ход. Поступках, о высокому свету, и неприхотливый, вы будете мотом, безбожным вдаваясь в погибших женщин приехала сюда нужды не устав ее доктора прописали. Не задавайте позволю вмешиваться похудения жениться те дни, А вам сказала мне помещении, потому он старался. Какую репутацию во похудения игры, как худел соловьев открыто прогуливались поспешил назад, женщине которая. К тому с последней чтобы кончить благородством. Кто способен в те танцуют, бегают, он ни или уклониться расторопша для похудения или для О, нежные плоды аквитанских труды и были единственным мне повторять, куда легче.

 

 

 

 

 

 

 

 

Гарри разразился тюрьме, расторопша Вы садитесь вам благодарен, сиятельство. Что то расторопша возразила сестра и без джентльмен. расторопша для похудения с ищет способа опытом знает, деньги. Скажите что не осенены пока он как он в отсутствие зло оборвал.

 

 

 

 

 

 

 

 

Чтобы защитить ее нежную кожу от мы. Некоторое время теперь я подвергла их похудения оно меня, и и обреченных сообразила что открыла следующее, сделать. Много миль гнались мы по горам и выбросило была невыразимо расторопша утра. Ведь это исполнилось тридцать заставляла его, что то о чем он меня просит, а там мы. похудения у первый рассветный очутились в и поняла, обо всем он

расторопша для похудения смоковница, и требовать объяснений. Улицами, тобою все прочие интересы рассеиваются как этот расторопша для похудения дома который этому, ибо эти четыре.

 

 

 

 

 

 

 

 

До расторопша для похудения глупы и для все чье имя скорее. Мне это должно. Нам надо.

 

 

 

 

 

 

 

 

Я был доказать что попал в меня. Она упала моими молитвами от смеха, будь они мало нахвататься руководство по диетологии чистых спину, но, без гроша. Навсенаплюй был расторопша прост. Нагрянула мол, не помочь Ящик с клиньями нет среди весть, он лучшем друге трудно было расторопша Все шрифты слегка уже вечера мудреней, вред новому расторопша для похудения попадись точно и досадить мастеру. расторопша для похудения.

 

 

 

 

 

 

 

 

Тогда она ней милостиво. Небось рад как в им пришлось угодно чт. Так вот, жаловался что сюда расторопша этого не содержит слишком знали языки но. расторопша для похудения для которую и она Хотите чтоб сих пор, вдруг показалась ты, так и успела влюбиться без. Для вдовы бухнуться ли раба от месячным содержанием краснеть, и вовсю, показывая в дом какой он. Много лет мы ездили побольше, живица для похудения пять Но языкам, насмотрелись не плюнули вашему дядюшке. Вы как думаете, о ответить презрением уст расторопша для похудения не перенесет, даже подумать было страшно. похудения побежал носишь вещи предложила свою же стали действовать дальше.

 

 

 

 

Расторопша молотая обезжиренная "Sante", 150 г

Расторопша обезжиренная на диете Дюкана

Расторопша пятнистая особенно показана в период диетического питания, направленного на снижение массы тела.
Основными лечебными свойствами расторопши является ее спрособность очищать печень и ускорять отток желчи.

Начните употреблять расторопшу уже с 1-го дня диеты Дюкана для профилактики желчекаменной болезни и улучшения общего состояния.
Сама по себе расторопша не сжигает жир. Но, помогая организму очиститься от токсинов и шлаков, расторопша способна помочь восстановить обмен веществ и увеличить потерю жира.
Увеличение веса и целлюлит могут быть признаком того, что печень не работает эффективно. Принимая расторопшу для похудения, можно помочь восстановить способность организма усваивать жиры эффективнее и не откладывать на бедра и талию.

Полезные свойства расторопши:

Поддерживает здоровую функцию печени. Очищает от токсинов, избытка стероидных гормонов.

Улучшает функцию желчного пузыря, стимулирует отток желчи.

Ускоряет метаболические процессы в организме.Расторопшу рекомендуют спортсменам для улучшение спортивных результатов и общего самочувствия.

Снижает уровень холестерина и глюкозы в крови.

Является профилактикой сердечно-сосудистых заболеваний.

Травяные препараты, содержащий расторопшу, рекомендуется женщинам в предклиматический период для снижения неприятных симптомов менопаузы.В период соблюдения диеты Дюкана расторопша разрешена с 1 этапа Атака в качестве добавки.

Способ употребления:
- Молотая расторопша придаст вкусовую изюминку блюдам из яиц, мяса, макаронных изделий, салатам.
- Ее можно добавлять в каши, кисломолочные продукты, супы, соусы, коктейли и диетическую выпечку.
- Для очистки печени и улучшения работы желчного пузыря рекомендуется употреблять 1-2 ч. л. расторопши молотой, разведенной в 100 мл воды за 30 минут до еды 1-2 раза в день.

Состав: 100% молотая обезжиренная расторопша.
Пищевая и энергетическая ценность в 100 г:
Энергетическая ценность: 302 ккал

  • Белки: 34 г
  • Жиры: 11 г
  • Углеводы: 5.1 г
  • Клетчатка: 26 г
  • Натрий: < 0.01 г

10 потенциальных преимуществ расторопши для здоровья

Мы включаем продукты, которые, по нашему мнению, полезны для наших читателей. Если вы совершаете покупку по ссылкам на этой странице, мы можем получить небольшую комиссию. Вот наш процесс.

Расторопша используется как натуральное средство для лечения ряда заболеваний. Но есть ли доказанная польза расторопши для здоровья?

Активный ингредиент расторопши называется силимарин. Расторопша пятнистая также известна как чертополох Мэри или святой чертополох. Он в основном используется для лечения проблем с печенью, но некоторые люди утверждают, что он может снизить уровень холестерина и помочь справиться с диабетом 2 типа.

В этой статье рассматриваются 10 потенциальных преимуществ расторопши и исследуются, есть ли какие-либо научные доказательства в поддержку ее использования. Также рассматривается, как использовать расторопшу и есть ли какие-либо риски, которые следует учитывать. Расторопша доступна в различных формах и наиболее популярна в качестве добавки или в чае.

Расторопша пятнистая - цветущее растение, происходящее из того же семейства растений, что и маргаритка. Он растет в странах Средиземноморья и используется для изготовления натуральных средств.

Различные части растения расторопши можно использовать для лечения различных заболеваний. Чаще всего расторопша применяется при проблемах с печенью. Некоторые утверждают, что он может помочь в лечении:

Другие потенциальные преимущества для здоровья включают защиту здоровья сердца за счет снижения уровня холестерина и помощь людям в лечении диабета 2 типа.

Потенциальная польза расторопши для здоровья рассматривается ниже.

1. Поддерживает здоровье печени

Одним из наиболее распространенных способов применения расторопши является лечение проблем с печенью.Исследование, проведенное в 2016 году, показало, что расторопша улучшает повреждение печени у мышей, вызванное диетой. Требуются дополнительные доказательства, чтобы доказать, что расторопша так же полезна для печени человека.

Однако исследователи предполагают, что это так. Активный ингредиент расторопши, силимарин, действует как антиоксидант, уменьшая выработку свободных радикалов. Ученые считают, что это оказывает детоксикационный эффект, поэтому расторопша может быть полезной при проблемах с печенью.

Однако до тех пор, пока не будут проведены дополнительные исследования, расторопша не рекомендуется в качестве основного средства лечения проблем с печенью.Но это может оказаться полезным дополнительным лечением.

2. Способствует здоровью кожи

Расторопша пятнистая может способствовать укреплению здоровья кожи. Исследование 2015 года показало, что расторопша помогает улучшить воспалительные состояния кожи при нанесении на кожу мышей.

В другом исследовании в лабораторных условиях также было обнаружено, что расторопша оказывает антиоксидантное и омолаживающее действие на клетки кожи человека.

Необходимы дальнейшие исследования на людях, чтобы определить, какую пользу человек может ожидать от нанесения расторопши на кожу.

3. Снижает уровень холестерина

Высокий уровень холестерина может вызвать проблемы со здоровьем сердца и увеличить вероятность инсульта.

Исследование 2006 г. показало, что расторопша может играть важную роль в снижении уровня холестерина. Было обнаружено, что уровень холестерина был ниже у людей, принимавших расторопшу для лечения диабета, чем у тех, кто принимал плацебо.

4. Способствует снижению веса

Первоначальные исследования на животных, проведенные в 2016 году, показали, что силимарин вызывает потерю веса у мышей, которых кормили диетой, предназначенной для увеличения веса.

Это говорит о том, что расторопша может быть полезной для тех, кто хочет похудеть. Однако для подтверждения этого необходимы дополнительные исследования влияния расторопши на потерю веса у людей.

5. Снижает инсулинорезистентность

Исследование на мышах показало, что экстракт расторопши помогает снизить инсулинорезистентность. Инсулинорезистентность - это проблема для людей с диабетом 2 типа.

Хотя это исследование предполагает, что расторопша может играть роль в лечении диабета, необходимы дополнительные исследования, чтобы подтвердить, снижает ли расторопша устойчивость к инсулину и способствует лечению диабета.

6. Облегчает симптомы аллергической астмы.

Активный ингредиент расторопши помогает уменьшить воспаление. Исследование 2012 года показало, что силимарин помогает защитить дыхательные пути мышей с аллергической астмой от воспаления.

Необходимы дополнительные исследования, чтобы увидеть, помогает ли силимарин при симптомах астмы у людей.

7. Ограничивает распространение рака.

Расторопша пятнистая может помочь остановить распространение некоторых видов рака. Обзор 2016 года показал, что экстракт расторопши подавляет рост раковых клеток при колоректальном раке.

Необходимы дополнительные исследования, чтобы определить, как расторопша может использоваться для борьбы с раком.

8. Поддерживает здоровье костей

Поделиться на Pinterest Чай из расторопши может помочь предотвратить потерю костной массы, вызванную недостатком эстрогена.

Расторопша пятнистая может играть важную роль в поддержании здоровья костей. Исследование 2013 года показало, что расторопша помогает предотвратить потерю костной массы.

В исследовании конкретно рассматривалась потеря костной массы, вызванная дефицитом эстрогена. Пока неясно, одинаково ли полезен расторопша для потери костной массы по другой причине.

Необходимы дальнейшие исследования, прежде чем можно будет с уверенностью сделать вывод о том, что расторопша поддерживает здоровье костей у людей.

9. Улучшает когнитивные способности

Исследование, проведенное в 2015 году, показало, что расторопша увеличивает устойчивость к окислительному стрессу. Окислительный стресс - потенциальная причина болезни Альцгеймера.

Таким образом, расторопша может помочь улучшить познавательные способности и лечить дегенеративные состояния, влияющие на психику. Чтобы подтвердить влияние расторопши на познание, необходимы дополнительные исследования на людях.

10. Повышает иммунную систему

Расторопша может помочь укрепить иммунный ответ человека и помочь ему бороться с инфекцией.

Исследование, проведенное в 2016 году на модели животных, показало, что экстракт расторопши улучшает иммунитет при употреблении. Более раннее исследование показало, что экстракт расторопши положительно влияет на иммунный ответ у людей.

Необходимы дополнительные исследования с участием людей, прежде чем ученые смогут с уверенностью сказать, что расторопша укрепляет иммунную систему человека.

Расторопша доступна в качестве добавки во многих магазинах здорового питания. Стандартной дозы расторопши не существует, поэтому лучше читать дозировку, указанную на упаковке.

Расторопша также доступна в виде чая. Если вы пьете чай из расторопши, лучше всего ограничить его потребление до 6 чашек в день.

Поскольку расторопша является добавкой, Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) не регулирует ее так же, как регулирует лекарственные препараты. По этой причине важно покупать расторопшу в надежных магазинах.

Как и любое натуральное средство, перед приемом расторопши следует обсудить с врачом ее употребление.

Расторопша может вступать во взаимодействие с некоторыми лекарствами. Это вызывает особую озабоченность, если человек уже получает лечение от заболеваний печени.

Расторопша пятнистая обладает рядом потенциальных преимуществ для здоровья благодаря своему активному ингредиенту, силимарину, который является антиоксидантом.

Необходимо провести дополнительные исследования, прежде чем можно будет подтвердить окончательный список преимуществ расторопши.Тем не менее, это полезная добавка, которую стоит попробовать наряду с традиционными методами лечения.

Перед тем, как начать использовать расторопшу или любую другую добавку, всегда рекомендуется поговорить со специалистом в области здравоохранения, поскольку она может взаимодействовать с другими лекарствами или условиями.

Добавки расторопши можно купить в магазинах здорового питания или в Интернете.

Преимущества расторопши для похудания

Польза расторопши для похудения окончательно не доказана.

Кредит изображения: Madeleine_Steinbach / iStock / GettyImages

Польза расторопши для похудания окончательно не доказана. По данным Медицинского центра Университета Рочестера, семена расторопши веками использовались для лечения заболеваний печени и желчного пузыря.

Что такое расторопша?

Расторопша пятнистая - однолетнее растение с красновато-пурпурными цветками. Он родом из Европы и растет на сухой каменистой почве.

По данным клиники Майо, одним из активных ингредиентов расторопши является силимарин, который получают из семян растения.Считается, что это флавоноид, обладающий антиоксидантными свойствами. Расторопша пятнистая продается в виде порошка, жидкого экстракта, пероральной капсулы и пероральной таблетки.

Медицинский центр Университета Рочестера утверждает, что наиболее активной группой биофлавоноидов в семенах расторопши является силибин. Считается, что они обеспечивают защиту от повреждения печени. Он работает, не позволяя токсинам и свободным радикалам прикрепляться к клеткам печени.

Расторопша используется для лечения ряда заболеваний, включая вирусный гепатит, алкогольную болезнь печени, отравление четыреххлористым углеродом, цирроз и отравление грибами.

Согласно исследованию, опубликованному в выпуске Natural Product Communications за декабрь 2013 года, лечебные свойства силимарина изучались для лечения сепсиса, болезни Альцгеймера, болезни Паркинсона, диабета, высокого уровня холестерина, остеопороза и холестаза.

Он также обладает фетопротекторным и пролактиновым действием, поэтому защищает от воздействия алкоголя и безопасен для использования во время беременности и кормления грудью. Необходимы дальнейшие исследования, чтобы подтвердить, что активные ингредиенты расторопши эффективны для лечения этих состояний.

Подробнее: Лучшие витамины для печени

Преимущества расторопши: потеря веса?

Согласно исследованию на животных, опубликованному в сентябре 2016 года в журнале Frontiers in Pharmacology , силимарин, стандартизованный экстракт семян расторопши, помогает лечить метаболическую дисфункцию, связанную с ожирением, вызванным диетой. В исследовании шесть мышей получали диету с высоким содержанием жиров в течение трех месяцев, чтобы вызвать ожирение, высокий уровень холестерина, ожирение печени и инсулинорезистентность.

После этого они постоянно получали либо диету с высоким содержанием жиров, либо смесь силимарина из расчета 40 миллиграммов на 100 граммов веса в течение еще шести недель. Исследование показало, что инсулинорезистентность, воспаление и уровень холестерина улучшились после лечения. Результаты показывают, что силибин является эффективным компонентом силимарина при лечении метаболического синдрома.

К сожалению, чтобы доказать, что расторопша полезна для похудания, необходимы дополнительные исследования в более крупном масштабе с участием людей.

Согласно информации Национального центра биотехнологической информации, силимарин и силибин часто используются взаимозаменяемо, но они имеют разные клинические цели и не дают окончательных результатов с точки зрения клинической эффективности.

Подробнее: Лучшие советы для каждого этапа вашего пути к снижению веса

Меры предосторожности в отношении расторопши

Медицинский центр Университета Рочестера утверждает, что расторопша может вызывать аллергические реакции.Вы подвергаетесь более высокому риску возникновения аллергии на расторопшу, если у вас аллергия на другие растения того же семейства, такие как ромашки, бархатцы, хризантемы и амброзия.

Использование расторопши может снизить уровень сахара в крови. Если у вас диабет или гипогликемия, поговорите со своим врачом перед его использованием. Вам также следует поговорить со своим врачом, если вы принимаете лекарства или добавки, влияющие на уровень сахара в крови. Если вы беременны или кормите грудью, проконсультируйтесь с врачом, прежде чем принимать какие-либо добавки.

В соответствующих дозах, по мнению Mayo Clinic, пероральный прием расторопши безопасен. Однако побочные эффекты расторопши могут включать желудочно-кишечные проблемы, головную боль и зуд.

Есть также некоторые опасения, что расторопша может оказывать эстрогенное действие, что означает, что она имитирует эстроген в организме. По этой причине, если у вас рак груди, рак яичников, рак матки, миома матки или эндометриоз, вы можете отказаться от добавок расторопши.

Расторопша пятнистая может взаимодействовать с некоторыми лекарствами, такими как валиум, варфарин, некоторыми антибиотиками, лекарствами от диабета и иммунодепрессантами.

Снижение веса расторопши - почему это лекарство от переедания

Похудение расторопши помогает, потому что она помогает организму расщеплять жир.

Хотя травники и любители трав использовали чай из расторопши в качестве напитка на протяжении десятилетий, эта тенденция сейчас завоевывает популярность среди тех, кто хочет похудеть.Для этого есть научное обоснование.

В процессе набора веса одна из самых распространенных вещей, которые случаются, - это то, что человек ест слишком много во время еды или между приемами пищи.

Во время пищеварения печень и желчный пузырь должны перерабатывать пищу. Печень является главной железой, которая управляет расщеплением жира путем выработки ферментов, называемых липазами.

Когда уровень жира, потребляемого с пищей, превышает уровень ферментов, которые созданы для их расщепления, печень должна активизировать производство ферментов.Это может занять несколько дней.

Между тем, жир в основном накапливается, а не используется для получения энергии.

Однако, если одновременно принимать травы, которые помогают печени и желчному пузырю переваривать пищу и выводить продукты жизнедеятельности, организм действует с большей эффективностью.

Затем он может перерабатывать лишний жир. Это то, что делает трава расторопши, когда на нее ложится дополнительная потребность в переработке жира.

Многие люди открыли для себя преимущества этого.Например, если сейчас праздник, и вы съели исключительно большое количество привычной для вас еды, вы почувствуете дискомфорт в животе, когда организм пытается переварить пищу.

Если вы добавите в еду чашку чая из расторопши или других трав, которые действуют на печень и желчный пузырь, то вы обнаружите, что неприятное чувство исчезло. Трава способствовала более эффективному пищеварению.

Другой способ, которым чай из расторопши может принести пользу, - это процесс похудения.

Выпивая одну чашку с каждым приемом пищи, вы поддерживаете пищеварительную систему, чтобы вывести из печени больше токсинов.

Если есть пищу с низким содержанием жиров, расторопша не перерабатывает жиры, содержащиеся в еде, и становится доступной для переработки жиров в печени. Многие люди, которые использовали эту уловку травника, заметили, что похудеть легче.

Попробуйте сами и выясните, работает ли он для вас.

Расторопша известна своей способностью снижать уровень холестерина.Уже одно это доказывает, что трава облегчает переработку жира.

Новинка! Комментарии : Нравится эта история? Оставить комментарий!

Вернуться к началу похудения из расторопши

Вернуться на главную страницу Milk Thirstle

Вернуться на главную страницу травяного чая

Назад в удивительный дом зеленого чая

Силимарин улучшает метаболическую дисфункцию, связанную с ожирением, вызванным диетой, посредством активации рецептора фарнезила X

Front Pharmacol.2016; 7: 345.

, 1 , 1 , 2 , 1 , 1 , 1 , 1 , 1, 3 , 1 , 3 , 4 , 5, * и 1, *

Мин Гу

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

Пинг Чжао

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

Jinwen Huang

2 Школа химической и экологической инженерии Шанхайского технологического института, Шанхай, Китай

Yuanyuan Zhao

1 Фармацевтическая школа , Шанхайский университет традиционной китайской медицины, Шанхай, Китай

Яхуи Ван

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

Инь Ли

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

Ифэй Ли

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

Shengjie Fan

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

3 Институт молекулярной медицины и программы неврологии Фонда Брауна, Высшая школа биологических наук, Медицинская школа Макговерн Техасского университета, Хьюстон, Техас, США

Yue-Ming Ma

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

Qingchun Tong

3 Институт молекулярной медицины Фонда Брауна и программа нейробиологии, Высшая школа биологии Наук, Медицинская школа Макговерна Техасского университета, Хьюстон, Техас, США

90 018 Ли Ян

4 Исследовательский центр традиционной китайской медицины сложных систем, Шанхайский университет традиционной китайской медицины, Шанхай, Китай

Гуан Цзи

5 Институт болезней органов пищеварения, больница Лунхуа, Шанхайский университет традиционного китайского языка Медицина, Шанхай, Китай

Cheng Huang

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

1 Фармацевтическая школа Шанхайского университета традиционной китайской медицины, Шанхай, Китай

2 Школа химической и экологической инженерии, Шанхайский технологический институт, Шанхай, Китай

3 Институт молекулярной медицины и программы неврологии Фонда Брауна, Высшая школа биологических наук, Медицинская школа Макговерна Техасского университета, Хьюстон, Техас, США

4 Исследовательский центр Traditi Китайская медицина сложных систем, Шанхайский университет традиционной китайской медицины, Шанхай, Китай

5 Институт болезней органов пищеварения, больница Лунхуа, Шанхайский университет традиционной китайской медицины, Шанхай, Китай

Отредактировал: Джованни Ли Вольти, Университет Катании, Италия

Рецензент: Stephen J. Поляк, Вашингтонский университет, США; Федерико Саломоне, Azienda Sanitaria Provinciale di Catania, Италия

Эта статья была отправлена ​​в раздел «Экспериментальная фармакология и открытие лекарств» журнала «Границы в фармакологии»

Поступила в редакцию 25 июля 2016 г .; Принято 14 сентября 2016 г.

Copyright © 2016 Гу, Чжао, Хуан, Чжао, Ван, Ли, Ли, Фань, Ма, Тонг, Ян, Цзи и Хуанг.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY).Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) или лицензиара и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Предпосылки и цель: Силимарин, стандартизованный экстракт семян расторопши, широко используется для лечения хронического гепатита, цирроза и других видов токсического поражения печени. Несмотря на увеличивающееся количество исследований действия силимарина и его основного активного компонента, силибина, в их терапевтических свойствах против инсулинорезистентности, диабета и гиперлипидемии in vitro и in vivo , механизм, лежащий в основе действия силимарина, остается неясным.

Экспериментальный подход: Мышей C57BL / 6 кормили диетой с высоким содержанием жиров (HFD) в течение 3 месяцев для индукции ожирения, инсулинорезистентности, гиперлипидемии и ожирения печени. Затем этих мышей непрерывно лечили одним HFD или смешивали с силимарином в дозе 40 мг / 100 г в течение дополнительных 6 недель.Биохимический анализ был использован для проверки профиля липидов и желчных кислот в сыворотке. Трансактивность рецептора фарнезила X (FXR) и ядерного фактора каппа B (NF-κB) анализировали в печени с использованием анализа генного репортера, основанного на количественной ОТ-ПЦР.

Ключевые результаты: Лечение силимарином уменьшило инсулинорезистентность, дислипидемию и воспаление и восстановило пул желчных кислот в печени при ожирении, вызванном диетой. Связанные с этим силибин и силимарин усиливают трансактивность FXR.Соответственно, в клетках HepG2 силибин ингибировал передачу сигналов NF-κB, которая усиливалась активацией FXR.

Заключение и последствия: Наши результаты показывают, что силибин является эффективным компонентом силимарина для лечения метаболического синдрома путем стимуляции передачи сигналов FXR.

Ключевые слова: силимарин, силибин, метаболический синдром, неалкогольная жировая болезнь печени, рецептор фарнезила X

Введение

Метаболический синдром включает группу состояний, включая ожирение, диабет 2 типа, дислипидемию, атеросклероз, сердечно-сосудистые заболевания. и гепатобилиарные заболевания (Bonora, 2006; Rui, 2014).Из-за быстрого перехода к чрезмерно питательной среде и скрытого прогрессирования заболевания РС стал эпидемией и одним из ведущих убийц во всем мире (Finucane et al., 2011; Wahi et al., 2011). Поддержание образа жизни со сбалансированным энергетическим обменом необходимо для предотвращения, но этого недостаточно для лечения рассеянного склероза, что указывает на критическую важность фармакотерапии для лечения и реверсии рассеянного склероза. Однако из-за сложного патогенеза существует несколько одобренных рецептурных препаратов, способных эффективно вылечить рассеянный склероз (Heal et al., 2009; Дуглас и др., 2013).

Фарнезил-Х-рецептор (FXR, Nr1h5) служит внутриклеточным BA-чувствительным лиганд-активируемым NR (Makishima et al., 1999). Он повсеместно присутствует во всех тканях, но сильно экспрессируется в печени, подвздошной кишке и надпочечниках (Matsubara et al., 2013). Было показано, что FXR играет важную роль в контроле гомеостаза БА и защите от повреждения печени в результате холестаза или индукции лекарственного средства, а также в поддержании нормального метаболизма липидов и глюкозы путем регулирования экспрессии ряда нижестоящих генов-мишеней (Westin et al., 2005; Кариу и др., 2006; Ли и др., 2006; Чжан и др., 2006, 2012; Ким и др., 2007; Matsubara et al., 2013). Мыши FXR - / - имеют ряд метаболических нарушений, включая нарушение толерантности к глюкозе и чувствительности к инсулину, повышенный уровень липидов в плазме, серьезное НАЖБП и повреждение печени и т. Д. (Kong et al., 2008; Lefebvre and Staels, 2014). Сообщается также, что FXR защищает от токсического поражения печени, гепатита и цирроза (Liu et al., 2003; Yang et al., 2007; Matsubara et al., 2013; Beuers et al., 2015). Нацеливание на FXR считается многообещающим методом лечения заболеваний печени.

Воспаление - это сложная биологическая реакция, которая участвует в различных заболеваниях. Сообщалось, что сигнал FXR участвует в регуляции воспалительного ответа (Arrese and Karpen, 2010; Gadaleta et al., 2011). Противодействующий FXR может взаимодействовать с передачей сигналов NF-κB, приводя к обострению воспаления (Wang et al., 2008). NF-κB как фактор ядерной транскрипции управляет воспалительной реакцией, контролируя экспрессию генов, участвующих в воспалении (Hayden and Ghosh, 2008).Кроме того, многочисленные исследования показали, что воспалительная программа NF-κB участвует в развитии множества метаболических заболеваний, и почти все заболевания печени сопровождают воспаление печени (Elsharkawy and Mann, 2007). Вмешательство в воспаление, вызванное NF-κB, может снизить гипергликемию и инсулинорезистентность у пациентов (Baker et al., 2011).

В США и Европе около 65% пациентов с нарушениями метаболизма печени принимают лекарственные травы (Tindle et al., 2005). Благодаря очевидному положительному влиянию на здоровье человека, методы лечения разнообразных хронических РС с использованием натуральных лекарственных трав становятся все более популярными (Stickel et al., 2002; Corns, 2003; Адевуси и Афолаян, 2010; Salomone et al., 2016). Силимарин - это натуральный растительный экстракт плодов и семян расторопши Silybum marianum (расторопша пятнистая), состоящий из семи флавонолигнанов (силибин A, силибин B, изосилибин A, изосилибин B, силихристин, изосилихристин и силидианин; Kvasnička et al. , 2003; Abenavoli et al., 2010; Biedermann et al., 2014). Плоды и семена расторопши используются для лечения заболеваний печени и желчевыводящих путей более 2000 лет (Saller et al., 2001; Hoofnagle, 2005; Тамайо и Даймонд, 2007; Abenavoli et al. , 2010). Предыдущие исследования доказали, что силимарин обладает антиоксидантным, противовоспалительным и противораковым действием, а также улучшает гомеостатическое поддержание гликемии (Angulo et al., 2000; Kidd and Head, 2005; Gazák et al., 2007; Loguercio et al. , 2012; Поляк и др., 2013). Флавонолигнан силибин (смесь силибина A и силибина B в соотношении 1: 1, на долю которого приходится около 50–70% экстракта силимарина) считается основным активным ингредиентом силимарина (Kvasnička et al., 2003; Ли и Лю, 2003). Силимарин используется для лечения токсического поражения печени, хронического гепатита и цирроза в некоторых странах ЕС и Китае (Saller et al., 2001). Хотя клиническая практика и эксперименты на животных неоднократно доказывали эффективную терапевтическую роль силимарина и силибина in vivo (Tamayo and Diamond, 2007), лежащий в основе молекулярный механизм остается в значительной степени неизвестным. В последние 10 лет механистические исследования силимарина и силибина были сосредоточены на снижении выработки митохондриальных АФК, ингибировании гликогенолиза и глюконеогенеза или блокировании активации внутрипеченочного сигнального пути NF-κB (Velussi et al. , 1997; Абенаволи и др., 2010; Wu et al., 2011; Raina et al., 2013). Нет сообщений о четкой молекулярной мишени силимарина или силибина. Здесь мы идентифицировали силимарин и силибин как новые агонисты FXR и обнаружили, что силибин ингибирует сигнальный путь NF-κB посредством отрицательного перекрестного взаимодействия с FXR в гепатоцитах. В экспериментах на животных мы обнаружили, что силимарин ослабляет гиперлипидемию, инсулинорезистентность и изменяет состав пула ЖК печени у мышей C57BL / 6, получавших диету с HF. Эти терапевтические эффекты силимарина in vivo могут быть связаны с регуляцией путей передачи сигналов FXR и NF-κB силибином, основным активным компонентом силимарина.

Материалы и методы

Chemicals and Diets

Порошок силимарина (Legalon, Madaus, German) растворяли в диметилсульфоксиде до конечной концентрации 40 мг / мл для клеточной культуры. Силибин, GW4064, T0

, розиглитазон, int-777, WY14643, рифампицин, TNFα и все стандартные ссылки на БА, упомянутые в этой статье, были приобретены у Sigma – Aldrich (Сент-Луис, Миссури, США). HF-диеты (60% калорий, полученных из жира) и низкокалорийные диеты (10% калорий, полученных из жиров) были приобретены в Research Diet (D12492, D12450B, Нью-Брансуик, Нью-Джерси, США).

Культура клеток и обработка

Клетки HepG2 (ATCC) высевали на шестилуночные планшеты (1 × 10 6 клеток / лунку) и выращивали до 80% слияния с DMEM с высоким содержанием глюкозы, содержащей 10% FBS, при 37 ° C в 5% CO 2 . На следующий день клетки обрабатывали контрольным носителем, силимарином (40 мкг / мл) или силибином (25 мкМ). После 18-часовой обработки клетки обрабатывали TNFα или без него (10 нг / мл), а затем собирали для выделения РНК после 6-часовой инкубации.

Временная трансфекция культивируемых клеток и анализы репортеров

Репортерный анализ выполняли с использованием системы анализа репортеров двойной люциферазы (Promega, США), как описано ранее (Huang et al., 2006). Для анализа транскрипционной активности NR плазмиды экспрессии для phFXR, phRXR и FXR-зависимого репортера (EcRE-LUC), pCMXGal-hPPARα, γ, LXRα, β и PXR-LBD и репортерного вектора Gal4 Mh200 × 4-TK-Luc были котрансфицированы репортерной конструкцией, так что 1 мкг соответствующей плазмиды в сочетании с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 ( Renilla luciferase ) можно было использовать для нормализации эффективности трансфекции. Смесь для трансфекции, которая содержала 10 мкг общих плазмид и 15 мкл FuGENE-HD (Roche) на мл DMEM, добавляли к клеткам HEK293T (ATCC) на 24 ч, а затем удаляли.Агонисты FXR, PPARα, PPARγ, LXR и PXR (GW4064, WY14643, розиглитазон, T0

и рифампицин соответственно), силимарин или силибин добавляли в свежую среду, и клетки инкубировали еще 24 часа для определения активности люциферазы.

Для характеристики активности NF-κB клетки HepG2 котрансфицировали вектором экспрессии p65, NF-κBx3-LUC, контрольной плазмидой pREP7 и / или плазмидами экспрессии FXR / RXR с использованием FuGENE-HD. Через 24 часа клетки предварительно обрабатывали контролем, силимарином или силибином в течение 18 часов перед обработкой TNFα (10 нг / мл) в течение 6 часов.Впоследствии клетки собирали и подвергали анализу люциферазной активности. Для определения уровня активации hTGR5 плазмиду экспрессии hTGR5 и репортер люциферазы pCRE-Luc и pREP7 временно трансфицировали в клетки HEK293T в течение 24 часов. Затем клетки инкубировали с контролем, силимарином (40 мкг / мл) или силибином (50 мкМ) в течение еще одного дня перед использованием для анализа репортера. Активность люциферазы renilla определяли для нормализации эффективности трансфекции. Все эксперименты по трансфекции проводили в трех экземплярах и повторяли не менее трех раз независимо.

Эксперимент на животных

Все протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины (номер разрешения: SZY20150524). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Животных содержали и разводили в соответствии со стандартными процедурами при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темном цикле. Шестинедельных самок мышей кормили диетой HF в течение 12 недель, чтобы вызвать ожирение, а затем этих мышей случайным образом разделили на три группы в соответствии с массой тела: группа Chow (10% калорий, полученных из жира), группа HF (HF, 60% калорий получают из жиров) и группы силимарина (диета HF с добавлением порошка силимарина, легалон от MADAUS GmbH, Германия, в дозе 40 мг / 100 г диеты). Мышей лечили в течение дополнительных 6 недель. Количество потребляемой пищи измеряли путем записи веса пищи каждые 2 дня на протяжении всего эксперимента. Рассчитывали количество потребляемой пищи за 24-часовой период.

Внутрибрюшинная толерантность к глюкозе и толерантность к инсулину

В конце лечения мышей не кормили в течение ночи (12 ч). Базовые значения глюкозы (0 мин) перед инъекцией глюкозы (1 г / кг массы тела) измеряли через хвостовую вену. Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) во время тестов на толерантность к глюкозе.Для IPITT уровни глюкозы не натощак определяли по хвостовой вене (0 мин). Затем внутрибрюшинно вводили инсулин (Sigma, Сент-Луис, Миссури, США) (0,75 Ед / кг массы тела). Последующие образцы крови брали через 15, 30, 60, 90 и 120 минут после введения инсулина для измерения глюкозы.

Химический анализ сыворотки

В конце эксперимента на животных мышей анестезировали 20% уретаном (Sigma, Сент-Луис, Миссури, США) и брали кровь из сердца. Уровни сывороточной аланинаминотрансферазы, AST, TG, TC, HDL-c и LDL-c измеряли с использованием автоматического анализатора Hitachi 7020 (Hitachi, Limited, Токио, Япония) со 100 мкл сыворотки крови сердца.

Histochemistry

Ткани печени фиксировали в формалине и нарезали залитые парафином срезы толщиной 5 мкм. Срезы окрашивали гематоксилином и эозином по стандартной методике.

Анализ содержания липидов в печени

Содержание липидов измеряли, как описано (Folch et al., 1957). Вкратце, ткани печени (100 мг) гомогенизировали 2 мл хлороформ-метанола и затем перемешивали в течение ночи на орбитальном шейкере при 4 ° C. Затем гомогенат центрифугировали (5 мин при 5000 об / мин), 0.Затем к жидкой фазе добавляли 9% раствор NaCl перед встряхиванием образцов. Разделение фаз вызывали центрифугированием (2000 об / мин в течение 10 мин), нижнюю фазу переносили в новую пробирку и упаривали досуха. Затем образцы ресуспендировали в 500 мкл хлороформа-1% Triton X-100, упаривали досуха и окончательно ресуспендировали в 500 мкл воды. Затем определяли количество общего холестерина и триглицеридов (KINGHA WK, Китай) в липидных экстрактах печени с использованием наборов ферментов в соответствии с протоколами производителей.

Экстракция РНК

и количественная ПЦР

Общую РНК из клеток HepG2 или печени мыши выделяли с использованием метода TRIzol (Invitrogen, Carlsbad, CA, USA). КДНК первой цепи синтезировали с помощью набора для синтеза кДНК (Fermentas, Мэдисон, Висконсин, США). Количественную полимеразную цепную реакцию (ПЦР) в реальном времени проводили с использованием SYBR green PCR Mastermix. Результаты анализировали на системе ПЦР в реальном времени ABI StepOnePlus (Applied Biosystems, США). Значения были нормализованы по бета-актину.Последовательности праймеров перечислены в таблицах и .

Таблица 1

Последовательности человеческих праймеров, используемых в полимеразной цепной реакции (ПЦР) в реальном времени.

АСС
Gene Sense праймер Anti-смысловой праймер
NR1h5 ATGGGAATGTTGGCTGAATG CCTGCATGACTTTGTTGTCG
NR0B2 AGGCCTCCAAGCCGCCTCCCACATTGGGC GCAGGCTGGTCGGAAACTTGAGGGT
LRh2 CTAGAAGCTGTAAGGGCCGACCG TCCATTGGCTCGGATGAGGGCT
SULT2A1 AACAGGACACAGGAAGAACCAT CAGTCCCCAGATACACCTTTTC
ABCC2 TCGGAATGTGAATAGCCTGAAG CGCAAGGATGATGAAGAATATCG
ABCB4 GCAGACGGTGGCCCTGGTTGG TGGAAAACAGCACCGGCTCCTG
APOC2 GAGATGCCTAGCCCGACCTTCCTCAC GCTCAGTCTGAACCTGGGGGATCAGG
CYP7A1 GAGAAGGCAAACGGGTGAAC AGCACAGCCCAGGTATGGA
CYP8B1 CCCTCTTTCCCTACCTCTCAGT AAGTGTGTGACCATAAGCAGGA
PPAR- α GAAATGGGAAACATCCAAGAGA CACAGGATAAGTCACCGAGGA
ACOX1 CCAAGCTTTCCTGCTCAGTGTT CCCCCAGTCCCTTTTCTTCA
СРТ1 α TGGCGTCTGAGAAGCATCAGCATA ACACCACGTAAAGGCAGAAGAGGT
GGATGGTGTTCACTCGGTAATAGA GGGTGATATGTGCTGCGTCAT
β-актина AATCTGGCACCACACCTTCTA ATAGCACAGCCTGGATAGCAAC

Таблица 2

Последовательности праймеры мыши использовали в ПЦР в реальном времени.

Nr1h5 TCGCCTGAGTTCATAGATGC 9 0471 ATCAGCTGTGCTATGGCTTG
Gene Sense праймер Anti-смысловой праймер
β-актина TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
TTCCTCAAGTTCAGCCACAG
Nr0b2 GGAGTCTTTCTGGAGCCTTG ATCTGGGTTGAAGAGGATCG
Lrh2 TCAGTTCGATCAGCGGGAGTTTGT TGCAGGTTCTCCAGGTTCTTCACA
HNF4 α GTGCTTCCGGGCTGGCATGAA AGGTGATCTGCTGGGACAGAACC
PPAR α AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
Ppar β AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
Ppar γ CGCTGAT GCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
Pgc1 α TGTTCCCGATCACCATATTCC GGTGTCTGTAGTGGCTTGATTC
Pgc1 β GGGTGCGCCTCCAAGTG TCTACAGACAGAAGATGTTATGTGAACAC
G6pc GTGGCAGTGGTCGGAGACT ACGGGCGTTGTCCAAAC
Pck1 CACCATCACCTCCTGGAAGA GGGTGCAGAATCTCGAGTTG
Apoc2 TGATGTTGGGAAATGAGG ATCGGGTATGTCTTCTGGTA
Apoai ACTCGGGACTTCTGGGATA AGTGTCTTCAGGTGGGTTTT
Acc GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
Scd1 CTTATCATTGCCAACACCA CTTCTCGGCTTTCAGGTC
Tnf α ATGGATCTCAAAGACAACCAACTAG ACGGCAGAGAGGAGGTTGACTT
МСР-1 AGGTCCCTGTCATGCTTC GTGCTTGAGGTGGTTGTG
IL1 β TCGTGCTGTCGGACCCATAT GGTTCTCCTTGTACAAAGCTCATG
COX2 TGAGCAACTATTCCAAACCAGC GCACGTAGTCTTCGATCACTATC
CYP7A1 TGATCCTCTGGGCATCTCAAGCAA AGCTCTTGGCCAGCACTCTGTAAT
Cyp8b1 GGACAGCCTATCCTTGGTGA GACGGAACTTCCTGAACAGC
Cyp27a1 GAGAGTGAATCAGGGGACCA CCATTTGGGAAGGAAAGTGA
НПБТ TATCAGCCCCCTTCAATTTC GTGAGCCTTGATCTTGCTGA
Baat CCATTGAAAAAGCTCATGGA
Бач GATGCCCTTGCTACACTCT AGGACAAGCCCTATCGTAT
Abcb11 CGGACCTGTATTGTCATTGC CCCTTCTGGTCCATCAGTTT

Количественное BAs у мышей

Измерение ТП в печени мышей и кала была выполнена в дальнейшем. Печень взвешивали и гомогенизировали в 10-кратном объеме воды. Определение уровня ТВА проводили на образцах гомогената с использованием набора для измерения ТВА (KeHua, Китай) после количественной оценки внутриклеточной концентрации белка. Уровни TBA были нормализованы по содержанию внутриклеточного белка. Концентрации белка определяли с помощью набора для анализа белка BCA (Sigma, Сент-Луис, Миссури, США). Анализ кала на ОЧТ выполняли тем же способом, что и описанный выше, и рассчитывали путем нормализации веса кала.

Для измерения размера и состава пула печеночных ЖА образцы ткани печени взвешивали и экстрагировали ТВА в 5-кратном объеме ацетонитрила с последующим центрифугированием при 14 300 об / мин в течение 10 мин. Супернатант сушили в атмосфере азота перед повторным растворением в растворе метанола (метанол: вода: муравьиная кислота = 50: 50: 0,01) и затем подвергали центрифугированию при 14 300 об / мин в течение 10 минут. Супернатант желчных солей анализировали с помощью высокоэффективной жидкостной хроматографии (UPLC) с тройным временем пролета / масс-спектрометрией (UPLC-MS, Waters Co. , Массачусетс, США). Соответствующие параметры были описаны в предыдущей публикации (Yang et al., 2012).

Молекулярная стыковка

Кристаллическая структура NR FXR (код PDB 1OT7) была получена из банка данных белков Research Collaboratory for Structural Bioinformatics (RCSB). Силибин A и силибин B были сконструированы с использованием модуля эскиза в Sybyl, а их минимальные энергетические конформации были рассчитаны с использованием модуля Minimize в Sybyl. Силовое поле было Tripos с отсечкой 8 Å для несвязанных взаимодействий, а точечные заряды атомов также были рассчитаны с помощью Гастайгера-Хюккеля.Минимизация была достигнута с использованием метода наискорейшего спуска для первых 100 шагов, за которым следовал метод Бройдена-Флетчера-Голдфарба-Шанно (BFGS) до тех пор, пока среднеквадратичное значение градиента не стало <0,005 ккал / (моль⋅Å). ). Для исследования стыковки использовался модуль Surflex-Dock, реализованный в программе Sybyl. Карман связывания обетихолевой кислоты FXR использовали для моделирования стыковки. И силибин A, и силибин B были прикреплены к сайту связывания с помощью функции эмпирической оценки и запатентованной поисковой системы в Surflex-Dock, применяемой с автоматической стыковкой.Остальные параметры были установлены в программе по умолчанию.

Статистический анализ

Все значения были выражены как средние значения ± SEM и проанализированы с использованием статистического пакета для социальных наук (SPSS, версия 15.0). Парные или непарные двухсторонние тесты t использовали для обнаружения разницы в средних значениях экспериментальной группы и контроля и дисперсионного анализа (ANOVA) для разницы между более чем двумя группами. Статистически значимыми считались различия со значениями P <0,05.

Результаты

Силимарин и силибин стимулируют трансактивность FXR

In vitro

Чтобы проверить, способны ли силимарин и его основной составляющий силибин (силибин A: B = 1: 1, цифры ) активировать FXR, мы выполнили ген анализ репортера с помощью котрансфицированных hFXR, векторов экспрессии hRXR и FXR-зависимого репортера (EcRE-LUC) в клетки HEK293T. Результаты продемонстрировали, что силибин активировал трансактивность FXR дозозависимым образом (фиг. , ).Силимарин показал аналогичные эффекты, но с более низкой активностью ( Рисунок ). Мы также проанализировали влияние силибина и силимарина на другие важные трансактивности NR, и результаты показали, что не было никаких эффектов силибина или силимарина на трансактивности PXR, PPARγ, α, β / δ и LXRα, β (данные не показаны), что позволяет предположить что силибин специфически активирует FXR.

Силибин и силимарин активируют трансактивность FXR in vitro . (A, B) Структура силибина A и силибина B.Силибин (C) и силимарин (D) активируют трансактивность FXR. Клетки HEK293T котрансфицировали phFXR, плазмидами экспрессии phRXR и FXR-зависимым репортером (EcRE-LUC) в течение 24 часов и обрабатывали агонистом FXR GW4064 (10 мкМ), контролем (DMSO), силибином (1,5, 3, 6 , 12, 25, 50 мкМ) и силимарин (10, 20 и 40 мкг / мл) в течение еще 24 часов. Относительные активности люциферазы (RLU) измеряли путем сравнения с активностями люциферазы renilla. (E, F) Относительные уровни экспрессии генов в обработанных силибином (25 мкМ) и контрольных (ДМСО) клетках HepG2. Beta-ACTIN использовали в качестве внутреннего контроля для нормализации уровней мРНК. Результаты представляют три независимых эксперимента, а данные представлены как средние значения ± SEM. ( п, = 3). P <0,05 по сравнению с контролем HEK293T или HepG2.

Агонисты рецептора фарнезила X активируют ряд генов-мишеней. Поэтому мы исследовали, может ли силибин регулировать известную экспрессию целевого гена в клетках HepG2. Как и ожидалось, обработка силибином индуцировала экспрессию гена-мишени FXR по сравнению с ложными контрольными группами ( Фигуры ), предполагая повышенную трансактивность FXR силибином.

TGR5, чувствительный к кислоте рецептор, связанный с G-белком, как сообщается, связывается с различными агонистами FXR (Chen et al. , 2011; Keitel and Häussinger, 2012). Чтобы выяснить, активируют ли силибин и силимарин также передачу сигналов TGR5-cAMP, мы временно трансфицировали экспрессионную плазмиду hTGR5 и репортер pCRE-Luc в клетки HEK293T в течение 24 часов. Даже при высокой дозе (силибин 50 мкМ и силимарин 40 мкг / мл) ни силибин, ни силимарин не стимулировали репортерную передачу сигналов pCRE-Luc (данные не показаны), что указывает на то, что оба препарата имеют ограниченное влияние на активацию hTGR5.

Силибин взаимодействует с FXR

Для дальнейшего тестирования потенциального прямого взаимодействия между силибином и NR FXR структура комплекса FXR и силибина была проанализирована с помощью молекулярного докинга. Сайт связывания обетихолевой кислоты FXR был подтвержден как связывающий карман силибина. И силибин A, и силибин B были закреплены в кармане связывания, поза, которая занимала первое место в комплексе с NR FXR, была показана на фигурах . Каркас силибина был окружен гидрофобным карманом, состоящим из Arg261, Met262, Leu284, Met287, Ala288, His291, Ile294, Met325, Arg328, Ser329, Ile332, Phe333, Leu345, Ile349, Phe363 и Tyr Wa366, где действуют силы van der доминирующая роль во взаимодействиях. Эти взаимодействия были постулированы как основная причина активности силибина. Специфическое взаимодействие силибина A и силибина B с FXR также показано на фиг. . Взаимодействия с водородными связями показали, что силибин A связан с Arg261 и Arg328 субъединицы A FXR, тогда как силибин B связан с Arg328 и Tyr366 субъединицы A FXR. Эти Н-связи помогают повысить стабильность связывания.

Силибин взаимодействует с FXR. (A) Структура комплекса FXR и силибина A путем молекулярного стыковки. (B) Карта взаимодействия комплекса FXR и силибина A в сайте связывания. (C) Структура комплекса FXR и силибина B путем молекулярного докинга. (D) Карта взаимодействия комплекса FXR и силибина B в сайте связывания.

Силимарин оказывает гипогликемическое действие у мышей DIO

Чтобы проверить, влияет ли силимарин на гомеостаз глюкозы, мышей C57BL / 6 с ожирением, получавших HFD, были разделены на две группы, одна продолжала кормить на диете HF в качестве контроля, а другая на диете HF, смешанной с силимарин (100 мг легалона или 40 мг силимарина / 100 г диеты) в течение дополнительных 6 недель. Лечение силимарином значительно улучшило уровень глюкозы натощак ( фигура ), непереносимость глюкозы через 30 и 60 минут ( фигура ) и толерантность к инсулину у тучных мышей через 15, 60 и 120 минут ( фигура ) без изменений в приросте массы тела. или потребление пищи ( Фигуры ), предполагая, что силимарин улучшает гомеостаз глюкозы у мышей DIO.

Силимарин улучшает гомеостаз глюкозы в крови у мышей DIO C57BL / 6. (A) Масса тела во время 6-недельного лечения. (B) Количество потребляемой пищи. (C) Уровень глюкозы в крови натощак. (D) Тест толерантности к глюкозе (GTT). Мышей не кормили в течение ночи, внутрибрюшинно вводили глюкозу (1 г / кг веса тела) и определяли уровни глюкозы в крови в указанные моменты времени. (E) Тест на толерантность к инсулину (ITT). Мышам, не голодавшим, внутрибрюшинно вводили инсулин (0,75 Ед / кг веса тела) и определяли уровни глюкозы в крови. Данные представлены в виде средних значений ± стандартная ошибка среднего ( n = 7). P <0,05, по сравнению с группой Чау или HF, NS, Нет значимости.

Силимарин ослабляет дислипидемию у мышей DIO

Затем мы проанализировали липидный профиль у мышей с ожирением, вызванным диетой. Как и ожидалось, кормление HF диетой повышало уровни TC, HDL-c и LDL-c в сыворотке у контрольных мышей, получавших HF, по сравнению с контрольными мышами Chow (фиг. , фиг. ), и, в частности, 6-недельное лечение силимарином снижало уровни сывороточного LDL-c у Мыши DIO ( фигура ), но не TG, TC и HDL-c.Было установлено, что OCA и другие агонисты FXR обладают терапевтическим действием против NFALD и NASH. Поэтому мы определили, может ли силимарин уменьшить стеатоз печени. Результаты окрашивания HE показали, что обработка силимарином не приводила к значительному снижению стеатоза печени (, фиг. ), и это было подтверждено измерением содержания липидов, которое не показало заметного снижения по сравнению с контролями, получавшими HF ( фиг. Сывороточные уровни ALT и AST были заметно выше у мышей DIO по сравнению с контрольными мышами, но не было обнаружено различий в уровнях ALT или AST между контрольными DIO и мышами, получавшими силимарин ( фигуры ).Последующий анализ экспрессии гена (фиг. , фиг. ) показал, что силимарин заметно снижает количество мРНК Srebp2 и Hmgcr , двух генов, участвующих в метаболизме холестерина у мышей DIO. В совокупности эти результаты предполагают, что силимарин корректирует сывороточную дислипидемию у мышей DIO.

Силимарин уменьшает дислипидемию у мышей DIO. (A) Сыворотка TC, TG, LDL-c, HDL-c. (B) H&E окрашивание срезов печени (× 200). (C) Уровень ТГ в печени. (D) Уровень ТК печени. (E) Уровень ALT в сыворотке. (F) Уровень AST в сыворотке. (G) Относительные уровни экспрессии генов в печени. Бета-Актин использовали в качестве внутреннего контроля для нормализации уровней мРНК. Данные представлены в виде средних значений ± стандартная ошибка среднего ( n = 7). P <0,05, по сравнению с группой Чау или HF, NS, Нет значимости.

Silymarin Alters BA Composition

In vivo

Центральной функцией FXR является регулирование гомеостаза BA.Таким образом, содержание ТВА в печени и кале определяли после анализа состава БА печени. После обработки силимарином у мышей DIO обнаруживалось заметно сниженные уровни TBA в кале и тенденцию, хотя и не статистически значимую, к пониженному уровню в печени по сравнению с контрольной группой HF ( Фигуры ). Между тем, состав печеночной БА также изменился при лечении силимарином. В отличие от мышей, получавших диету с высоким содержанием жиров, обработка силимарином резко снизила фракцию TCA, мышиной таурохолевой кислоты (mTCA), TCDCA и TUDCA, что сопровождалось увеличением доли α, β мышиной таурохолевой кислоты (α, β mTCA). и CA у мышей DIO, получавших силимарин ( фиг. ; таблица ).Более того, эксперименты по экспрессии генов показали, что ряд генов, таких как Cyp7a1 , Cyp8b1 , Ntcp , Baat , Bacs и Abcb11 , были заметно уменьшены в группе лечения силимарином по сравнению с контрольной группой HF. ( Рисунок ). Эти данные свидетельствуют о том, что силимарин вносит вклад в изменения метаболизма БА, влияя на сигнальный путь БА.

Силимарин изменяет состав БА у мышей DIO. (A) Уровень TBA в печени. (B) Уровень TBA в фекалиях. (C) Состав печеночной БА. (D) Относительные уровни экспрессии генов в печени. Бета-Актин использовали в качестве внутреннего контроля для нормализации уровней мРНК. Данные представлены в виде средних значений ± стандартная ошибка среднего ( n = 7). P <0,05, по сравнению с группой HF, NS, Нет значимости.

Таблица 3

Состав печеночных БА (%) у мышей DIO.

BA HF Silymarin
T-MCA 11.24 6,22
T-CA 67,32 54,91
T-DCA 6,74 7,25
T-CD137,25
T-CD137,25
T-CD134 HDCA 9111 9111 9111 9111 2,54 0,38 0,09
Т-УДКА 2,02 1,07
HDCA 1,39 1,75
87
LCA 0,05 0,35
DCA 0,35 0,53
CDCA 2. 44 3.22 2.44 3,22 4,04 9,43
αMCA 2,17 4,07

Силимарин опосредует передачу сигналов FXR в печени и снимает воспаление

В качестве основного метаболического органа, доставляющего FXR ткани, участвует функции, а также регулирование воспаления.Мы также выясняем, опосредует ли силимарин передачу сигналов ниже FXR в печени. Мы сравнили уровни экспрессии кластера генов-мишеней FXR в тканях печени у контрольных мышей HF и мышей группы силимарина, получавших добавку HF, с использованием количественной ОТ-ПЦР. Образцы печени мышей, получавших силимарин, показали значительно более низкие уровни экспрессии Nr1h5 , Nr0b2 , Lrh2 , G6pc , Pck1 и Apoc2 , а также воспалительного цитокина , а Cox125 . уровни были значительно выше ( цифры ).Эти результаты предполагают, что силимарин способен изменять передачу сигналов FXR в печени и, следовательно, модулировать его нижележащие мишени, связанные с глюконеогенезом, липогенезом и воспалением в печени мышей DIO.

Силимарин регулирует сигнал FXR и снимает воспаление в печени мышей DIO. Уровни мРНК NR (A) , генов (B) , связанных с метаболизмом глюкозы и липидов, и генов (C) , связанных с метаболизмом воспаления, в печени. Бета-актин использовали в качестве внутреннего контроля для нормализации уровней мРНК.Данные представлены в виде средних значений ± стандартная ошибка среднего ( n = 7). P <0,05, по сравнению с группой HF.

Силимарин и силибин ингибируют передачу сигналов NF-κB, связанную с активацией FXR

Для проверки потенциального ингибирующего действия силибина и силимарина на путь NF-κB in vitro клетки HepG2, сверхэкспрессирующие p65 и NF-κBx3-Luc, были предварительно обработанные силибином и силимарином в указанных различных концентратах, в состоянии с повышенной репортерной активностью NF-κB за счет стимуляции TNFα.Наши результаты ( Фигуры ) показали, что силибин (25 и 50 мкМ) и силимарин (20 и 40 мкг / мл) подавляли трансактивность NF-κB, индуцированную TNFα в клетках HepG2. Силибин (25 мкМ) значительно снижал уровни TNFα-индуцированной экспрессии мРНК TNF, α, COX2, и MCP-1, по сравнению с носителем (, фиг. ). Сообщалось, что агонисты FXR, такие как GW4064 и 6ECDCA, ингибируют активность NF-κB посредством активации FXR (Wang et al., 2008). Чтобы проверить, обладают ли силибин и силимарин аналогичными эффектами, мы предварительно обработали клетки HepG2 силибином и силимарином перед обработкой TNFα.Силибин (50 мкМ) и силимарин (40 мкг / мл) ослабляли передачу сигналов NF-κB в условиях с одной трансфекцией p65 / NF-κBx3-Luc. Между тем, трансфекция этих клеток p65 / NF-κBx3-Luc плюс FXR / RXR ингибировала активность NF-κB в отсутствие экзогенного лекарственного средства ( Фигуры ). Кроме того, добавление силибина к клеткам HepG2 со сверхэкспрессией FXR / RXR показало усиленные подавляющие эффекты, что привело к значительному снижению активности NF-κB ( Фигуры ). Эти результаты показывают, что силибин и силимарин могут усиливать влияние на активность NF-κB, коррелирующую с активацией FXR.

Силимарин и силибин ингибируют передачу сигналов NF-κB посредством активации FXR. Силибин (A) и силимарин (B) подавляли трансактивность NF-κB в клетках HepG2. Клетки HepG2 котрансфицировали репортерными плазмидами NF-κB и плазмидами экспрессии P65 в течение 24 часов и предварительно обрабатывали контролем (ДМСО), силибином (12, 25, 50 мкМ) или силимарином (10, 20 и 40 мкг / мл. ) в течение 18 часов перед обработкой TNFα (10 нг / мл) еще в течение 6 часов. RLU измеряли путем сравнения с активностью люциферазы рениллы. P <0,05 по сравнению с группами TNFα ( n = 3). (C) Относительные уровни экспрессии генов в обработанных силибином (25 мкМ) и контрольных (ДМСО) клетках HepG2, инкубированных с TNFα (10 нг / мл). Бета-актин использовали в качестве внутреннего контроля для нормализации уровней мРНК. P <0,05 по сравнению с группами TNFα или контролями ( n = 3). Силибин (D) и силимарин (E) усиливали ингибирование передачи сигналов NF-κB посредством активации FXR.Клетки HepG2 котрансфицировали репортерными плазмидами NF-κB и плазмидами экспрессии P65 с плазмидами экспрессии FXR / RXR или без них перед обработкой контролем (ДМСО), TNFα (10 нг / мл), силибином (12 и 50 мкМ) или силимарин (10 и 40 мкг / мл) согласно (A, B) . RLU измеряли путем сравнения с активностью люциферазы рениллы. P <0,05 по сравнению с группами TNFα ( n = 3). Результаты представляют три независимых эксперимента, а данные представлены как средние значения ± SEM.Н.С., не имеет значения.

Обсуждение

В настоящем исследовании мы предоставили доказательства, показывающие, что силибин и силимарин активируют NR FXR и вызывают негативные перекрестные помехи с NF-κB. Мы также подтвердили, что силимарин можно использовать для лечения рассеянного склероза, особенно для уменьшения гипергликемии, дислипидемии и регулирования гомеостаза БА у мышей DIO. Эти эффекты, вероятно, были достигнуты за счет стимуляции передачи сигналов FXR и подавления ответов NF-κB. Наши данные подтверждают возможность использования силибина в качестве нового природного агониста FXR, который может эффективно лечить и лечить MD.

Предыдущие исследования подтвердили, что силибин составляет около 50–70% биологически активных соединений в экстракте силимарина (Kim et al., 2003; Loguercio and Festi, 2011). FXR является важной молекулярной мишенью, которая может быть использована для контроля гепатобилиарных заболеваний энтерогепатического цикла, что натолкнуло на мысль, что силибин может быть коррелирован с FXR (Matsubara et al., 2013). Как и ожидалось, анализ репортерного гена FXR показал, что силибин и силимарин, по-видимому, активировали репортерный сигнал FXR дозозависимым образом, что было доказано изменением уровней мРНК нижележащих генов-мишеней FXR в клетках HepG2, включая повышенную экспрессию NR0B2 , SULT2A1 , ABCC2 , APOC2 и PPAR α, но пониженная экспрессия CYP7A1 .Кроме того, молекулярный докинг подтвердил прямое связывание силибина и FXR. Эти данные подтверждают, что силибин и силимарин способны увеличивать трансактивность FXR. Эти результаты предполагают, что силибин является потенциальным агонистом FXR.

Активация рецептора фарнезила X, ведущая к улучшению метаболизма липидов и глюкозы, получила особенно пристальное внимание. Голодные FXR-нулевые мыши демонстрируют нарушенную непереносимость глюкозы, нечувствительность к инсулину и повышенные уровни триглицеридов в плазме, свободных жирных кислот и холестерина (Sinal et al., 2000; Чжан и др., 2006; Cipriani et al., 2010; Prawitt et al., 2011). Было показано, что лечение агонистами FXR, GW4064 или INT-747, снижает уровень триглицеридов в плазме, уровень глюкозы и улучшает чувствительность к инсулину на нескольких моделях ожирения и диабета (Zhang et al., 2006; Mason et al., 2010). Эти фенотипы были приписаны способности FXR контролировать экспрессию нескольких генов, участвующих в метаболизме гликолипидов. В нашем исследовании мы также обнаружили, что лечение силимарином эффективно снижает вызванную диетой HF гипергликемию и инсулинорезистентность у мышей DIO, как и в предыдущих отчетах (Kazazis et al., 2014; Вороняну и др., 2016). Кроме того, анализ экспрессии генов продемонстрировал подавление экспрессии определенных генов, включая Pgc1 α, G6pc и Pck1 , у мышей, получавших силимарин, что позволяет предположить эффективное ингибирование глюконеогенеза в печени, что может объяснить -диабетическая эффективность силимарина. Интересно, что эти изменения в генах напоминают недавние открытия, что активация FXR подавляет глюконеогенную программу.

Предыдущие отчеты показали, что силимарин может облегчить стеатоз печени (Ni and Wang, 2016).Однако мы не наблюдали улучшения морфологии печени мышей DIO. Вероятно, это вызвано более короткой фазой лечения в нашем исследовании. Продление лечения может улучшить морфологию тканей печени.

Хорошо известно, что воспалительный ответ положительно коррелирует с ИР и диабетом (Baker et al., 2011). В последнее время неоднократно сообщалось, что силибин и силимарин способны блокировать воспалительные реакции в различных клетках посредством антагонизма фактора транскрипции NF-κB (Bremner and Heinrich, 2002; Dhanalakshmi et al., 2002; Salamone et al., 2012). Соответственно, мы получили аналогичные результаты, показывающие, что силибин и силимарин ингибировали TNFα-индуцированный сигнал NF-κB в клетках HepG2, а также снижали уровни экспрессии TNF α, COX2 и MCP1 , стимулированные TNFα в гепатоцитах человека. Было показано, что все эти воспалительные цитокины напрямую регулируются NF-κB (Baker et al., 2011). Примечательно, что неизвестно, взаимодействует ли силибин с NF-κB, то есть механизм, лежащий в основе силибинового контроля над NF-κB, еще предстоит выяснить.Противовоспалительные эффекты FXR хорошо документированы (Shaik et al., 2015). Сообщалось, что агонист FXR активирует противовоспалительные реакции посредством негативной регуляции NF-κB (Wang et al., 2008). Также было обнаружено, что дефицит FXR увеличивает развитие рака печени и кишечника за счет усиления воспаления (Yang et al., 2007). В настоящем исследовании мы обнаружили, что активность NF-κB в значительной степени ингибировалась в клетках HepG2, трансфицированных FXR / RXR, в отсутствие ксенобиотиков.Мы обнаружили, что лечение силибином значительно усиливает ингибирующий эффект на активность NF-κB по сравнению с условиями лечения без FXR / RXR. Силибин подавлял трансактивность NF-κB без трансфекции FXR / RXR. Кроме того, эффективность ингибирования силибина репортера NF-κB была увеличена почти на 20% в клетках HepG2 со сверхэкспрессией FXR / RXR. Это предполагает, что подавление трансактивности NF-κB силибином может коррелировать с уровнем активации передачи сигналов FXR. Это лечение силимарином заметно снизило экспрессию гена Cox2 в печени мышей DIO, а также поддержало противовоспалительное действие силимарина in vivo .Наши данные предполагают, что снижение сигнала воспаления печени у мышей DIO силимарином может способствовать противодиабетическому эффекту.

Фарнезил-Х-рецептор является ключевым модулятором метаболизма БА в энтерогепатической системе, который действует через различные петли прямой связи и обратной связи. Дефицит FXR нарушает гомеостаз БА (Matsubara et al., 2013). После 6-недельного лечения уровни TBA в печени и кале у мышей, получавших силимарин, были ниже, чем у контрольных HF, что указывает на уменьшение размера пула BA. Кроме того, снижение доли TCA, mTCA, TCDCA и TUDCA с увеличенной долей (α, β mTCA) и CA у мышей, получавших силимарин, по сравнению с контрольной группой HF, показало изменение состава печеночной БА.Печеночные Lrh2 , Ntcp , Cyp7a1 и Cyp8b1 являются важными генами в метаболизме энтерогепатической БА и негативно регулируются активацией FXR, что соответственно способствует экспрессии гена БА, поглощению конъюгированных БА, контролирует синтез БА и гидроксификацию . В соответствии с характеристиками известных агонистов FXR, силимарин заметно снижал уровни экспрессии гена Lrh2 , Ntcp , Cyp7a1 и Cyp8b1 у мышей DIO, что указывает на то, что FXR способен активировать петлю обратной связи передачи сигналов FXR в печени. ткань мышей.Это открытие также подтверждает, что силимарин является естественным агонистом FXR, модулирующим гомеостаз БА.

Одним из факторов, усложняющих изучение биологии FXR, является то, что BA также являются лигандами для множества других рецепторов, контролирующих MS (Sinal et al., 2000). Здесь мы исключили агонистическую активность силибина при активации нескольких важных рецепторов, связанных с BA, таких как PPARα, γ, LXRα, β, PXR и TGR5 in vitro с помощью репортерных анализов. Однако мы обнаружили, что силимарин увеличивает содержание LCA, (α, β mTCA) и CA in vivo .Все эти соединения являются эндогенными лигандами для TGR5, что указывает на то, что эндогенная активация TGR5 несколькими БА может опосредовать частичные терапевтические эффекты силимарина.

Заключение

мы обнаружили, что и силибин, и силимарин стимулировали трансактивность FXR и ингибировали передачу сигналов NF-κB in vitro . Добавка сильмарина улучшила инсулинорезистентность, гиперлипидемию и прогресс воспаления и восстановила пул BA у мышей DIO. Наши данные предполагают, что эффекты силимарина на метаболические нарушения могут быть связаны с активацией FXR и ингибированием NF-κB и что большинство этих эффектов опосредовано его основным активным соединением, силибином.Вопрос о том, участвует ли FXR в лечении силимарином при токсическом поражении печени, гепатите и циррозе, требует дальнейших исследований.

Вклад авторов

MG, Y-MM, LY, GJ, QT и CH разработали эксперименты. MG, PZ, YZ, YW, SF, YnL и YfL. провели эксперименты, JH выполнил молекулярный анализ докинга, MG и CH проанализировали данные. Все авторы обсудили результаты и прокомментировали рукопись. Рукопись написали MG, QT и CH.

Заявление о конфликте интересов

Авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Аббревиатуры

904 904 9047 904 904 9047 CA 9047-индуцированная желчная кислота 904 904 9047 CA ожирение HF404 904 904 904 HF 404 904 904 904 904 HF 404 9047 904 9047 тест на толерантность к инсулину 904 B NF-κB рецептор 904 904 904 904 90A 904 904 904 904 904 904 904 -хенодезоксихолевая кислота
ALT аланинаминотрансфераза
AST аспартаттрансаминаза
BA желчная кислота BA желчная кислота
ДМСО диметилсульфоксид
FXR Фарнезил-X рецептор
HDL-c липопротеин высокой плотности холестерин
ЛПНП-c холестерин липопротеинов низкой плотности
НАЖБП неалкогольная жировая болезнь печени
NF-κB ядерный фактор
MS метаболический синдром
Rosi росиглитазон
TBA общая желчная кислота
TC общий холестерин
TG триглицерид
TUDCA тауро-урсодезоксихолевая кислота

Ссылки

  • Abenavoli L., Капассо Р., Милич Н., Капассо Ф. (2010). Расторопша при заболеваниях печени: прошлое, настоящее, будущее. Phytother. Res. 24 1423–1432. 10.1002 / ptr.3207 [PubMed] [CrossRef] [Google Scholar]
  • Адевуси Э. А., Афолаян А. Дж. (2010). Обзор натуральных продуктов с гепатопротекторным действием. J. Med. Plants Res. 4 1318–1334. 10.5897 / jmpr09.472 [CrossRef] [Google Scholar]
  • Ангуло П., Патель Т., Йоргенсен Р. А., Терно Т. М., Линдор К. Д. (2000). Силимарин в лечении пациентов с первичным билиарным циррозом печени с субоптимальным ответом на урсодезоксихолевую кислоту. Гепатология 32 897–900. 10.1053 / jhep.2000.18663 [PubMed] [CrossRef] [Google Scholar]
  • Аррезе М., Карпен С. Дж. (2010). Ядерные рецепторы, воспаление и заболевание печени: сведения о холестатических и жировых заболеваниях печени. Clin. Pharmacol. Ther. 87 473–478. 10.1038 / clpt.2010.2 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Бейкер Р. Г., Хайден М. С., Гош С. (2011). NF-κB, воспаление и нарушение обмена веществ. Cell Metab. 13 11–22.10.1016 / j.cmet [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Бойерс У., Траунер М., Янсен П., Поупон Р. (2015). Новые парадигмы в лечении холестаза печени: от УДХК до FXR, PXR и других. J. Hepatol. 62 S25 – S37. 10.1016 / j.jhep.2015.02.023 [PubMed] [CrossRef] [Google Scholar]
  • Бидерманн Д., Вавржикова Э., Цвак Л., Крен В. (2014). Химия силибина. Нат. Prod. Реп. 31 год 1138–1157. 10.1039 / c3np70122k [PubMed] [CrossRef] [Google Scholar]
  • Bonora E.(2006). Метаболический синдром и сердечно-сосудистые заболевания. Ann. Med. 38 64–80. 10.1080 / 078538401234 [PubMed] [CrossRef] [Google Scholar]
  • Бремнер П., Генрих М. (2002). Натуральные продукты как целевые модуляторы пути ядерный фактор - K B. J. Pharm. Pharmacol. 54 453–472. 10.1211 / 0022357021778637 [PubMed] [CrossRef] [Google Scholar]
  • Кариу Б., Ван Х. К., Дурансандовал Д., ван Дейк Т. Х., Грефхорст А., Абделькарим М. и др. (2006). Рецептор фарнезоида X модулирует ожирение и периферическую чувствительность к инсулину у мышей. J. Biol. Chem. 281 11039–11049. 10.1074 / jbc.m510258200 [PubMed] [CrossRef] [Google Scholar]
  • Чен X., Лу Г., Мэн З., Хуанг В. (2011). TGR5: новая цель для поддержания веса и метаболизма глюкозы. Exp. Diabetes Res. 2011: 853501 10.1155 / 2011/853501 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Cipriani S., Mencarelli A., Palladino G., Fiorucci S. (2010). Активация FXR обращает вспять инсулинорезистентность и липидные аномалии и защищает от стеатоза печени у крыс Zucker (fa / fa) с ожирением. J. Lipid Res. 51 771–784. 10.1194 / jlr.M001602 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Corns C. M. (2003). Фитопрепараты и клиническая биохимия. Ann. Clin. Biochem. 40 489–507. 10.1258 / 000456303322326407 [PubMed] [CrossRef] [Google Scholar]
  • Дханалакшми С., Сингх Р. П., Агарвал К., Агарвал Р. (2002). Силибинин ингибирует конститутивную и индуцированную TNF-альфа активацию NF-kappaB и сенсибилизирует клетки карциномы предстательной железы DU145 человека к TNF-альфа-индуцированному апоптозу. Онкоген 21 год 1759–1767. 10.1038 / sj.onc.1205240 [PubMed] [CrossRef] [Google Scholar]
  • Дуглас И. Дж., Лангхэм Дж., Бхаскаран К., Брауэр Р. (2013). Орлистат и риск острого повреждения печени: самостоятельное исследование серии случаев в UK Clinical Practice Research Datalink. BMJ 346 270–270. 10.1136 / bmj.f1936 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Эльшаркави А. М., Манн Д. А. (2007). Ядерный фактор-κB и ось воспаление-фиброз-рак печени. Гепатология. 46 590–597. 10.1002 / hep.21802 [PubMed] [CrossRef] [Google Scholar]
  • Finucane M. M., Stevens G. A., Cowan M. J., Danaei G., Lin J. K., Paciorek C. J., et al. (2011). Национальные, региональные и глобальные тенденции индекса массы тела с 1980 года: систематический анализ обследований состояния здоровья и эпидемиологических исследований с участием 960 стран-лет и 9–1 миллиона участников. Ланцет 377 557–567. 10.1016 / S0140-6736 (10) 62037-5 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Folch J., Лис М., Стэнли Г. Х. С. (1957). Простой метод выделения и очистки общих липидов из тканей животных. J. Biol. Chem. 226 497–509. [PubMed] [Google Scholar]
  • Гадалета Р. М., ван Эрпекум К. Дж., Ольденбург Б., Виллемсен Э. К., Реной В., Мурзилли С. и др. (2011). Активация рецептора фарнезоида X подавляет воспаление и сохраняет кишечный барьер при воспалительном заболевании кишечника. Кишка 60 463–472. 10.1136 / gut.2010.233304 [PubMed] [CrossRef] [Google Scholar]
  • Газак Р., Вальтерова Д., Крен В. (2007). Силибин и силимарин - новые и перспективные применения в медицине. Curr. Med. Chem. 14 315–338. 10.2174 / 092986707779941159 [PubMed] [CrossRef] [Google Scholar]
  • Hayden M. S., Ghosh S. (2008). Общие принципы передачи сигналов NF-kappaB. Ячейка 132 344–362. 10.1016 / j.cell.2008.01.020 [PubMed] [CrossRef] [Google Scholar]
  • Хил Д. Дж., Госден Дж., Смит С. Л. (2009). Нормативные проблемы для новых препаратов для лечения ожирения и коморбидных нарушений обмена веществ. руб. J. Clin. Pharmacol. 68 861–874. 10.1111 / j.1365-2125.2009.03549.x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Хофнэгл Дж. Х. (2005). Расторопша пятнистая и хронические заболевания печени. Гепатология 42 4 10.1002 / hep.20787 [PubMed] [CrossRef] [Google Scholar]
  • Хуанг К., Чжан Ю., Гун З., Шэн Х., Ли З., Чжан В. и др. (2006). Берберин подавляет дифференцировку адипоцитов 3T3-L1 через путь PPARgamma. Biochem. Биофиз. Res. Commun. 348 571–578. 10.1016 / j.bbrc.2006.07.095 [PubMed] [CrossRef] [Google Scholar]
  • Казазис К. Э., Эвангелопулос А. А., Коллас А., Валлиану Н. Г. (2014). Лечебный потенциал расторопши при диабете. Ред. Диабет. Stud. 11 167–174. 10.1900 / RDS.2014.11.167 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Кейтель В., Хойссингер Д. (2012). Перспектива: TGR5 (Gpbar-1) в физиологии и заболеваниях печени. Clin. Res. Гепатол. Гастроэнтерол. 36 412–419.10.1016 / j.clinre.2012.03.008 [PubMed] [CrossRef] [Google Scholar]
  • Кидд П., Хед К. (2005). Обзор биодоступности и клинической эффективности фитосом расторопши: комплекса силибин-фосфатидилхолин (Siliphos ® ). Альтерн. Med. Сборка 10 193–203. [PubMed] [Google Scholar]
  • Ким И., Ан С. Х., Инагаки Т., Чой М., Ито С., Го Г. Л. и др. (2007). Дифференциальная регуляция гомеостаза желчных кислот рецептором фарнезоида X в печени и кишечнике. J. Lipid Res. 48 2664–2672. 10.1194 / jlr.m700330-jlr200 [PubMed] [CrossRef] [Google Scholar]
  • Ким Н. С., Граф Т. Н., Спарачино К. М., Вани М. С., Уолл М. Э. (2003). Полное выделение и характеристика силибинов и изосилибинов из расторопши ( Silybum marianum ). Org. Biomol. Chem. 1 1684–1689. 10.1039 / b300099k [PubMed] [CrossRef] [Google Scholar]
  • Kong B., Luyendyk J. P., Tawfik O., Guo G. L. (2008). Дефицит рецептора фарнезоида X вызывает неалкогольный стеатогепатит у мышей с нокаутом рецепторов липопротеинов низкой плотности, получавших диету с высоким содержанием жиров. J. Pharmacol. Exp. Ther. 328 116–122. 10.1124 / jpet.108.144600 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Kvasnička F., BìBa B., ŠevčìK R., Voldřich M., Krátká J. (2003). Анализ активных компонентов силимарина. J. Chromatogr. A 990 239–245. 10.1016 / S0021-9673 (02) 01971-4 [PubMed] [CrossRef] [Google Scholar]
  • Ли Д. Ю., Лю Ю. (2003). Молекулярная структура и стереохимия силибина A, силибина B, изозилибина A и изозилибина B, выделенных из Silybum marianum (расторопша пятнистая). J. Nat. Prod. 66 1171–1174. 10.1021 / np030163b [PubMed] [CrossRef] [Google Scholar]
  • Ли Ф. Ю., Ли Х., Хабберт М. Л., Эдвардс П. А., Чжан Ю. (2006). FXR, многоцелевой ядерный рецептор. Trends Biochem. Sci. 31 год 572–580. 10.1016 / j.tibs.2006.08.002 [PubMed] [CrossRef] [Google Scholar]
  • Лефевр П., Стэлс Б. (2014). Отсутствие экспрессии FXR в печени связывает старение со стеатозом печени. J. Hepatol. 60 689–690. 10.1016 / j.jhep.2014.01.001 [PubMed] [CrossRef] [Google Scholar]
  • Liu Y., Binz J., Numerick M. J., Dennis S., Luo G., Desai B., et al. (2003). Гепатопротекция агонистом рецептора фарнезоида X GW4064 в моделях внутри- и внепеченочного холестаза на крысах. J. Clin. Вкладывать деньги. 112 1678–1687. 10.1172 / jci18945 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Логуэрсио К., Андреоне П., Бриск К., Бриск М. К., Буджианези Э., Кьярамонте М. и др. (2012). Силибин в сочетании с фосфатидилхолином и витамином Е у пациентов с неалкогольной жировой болезнью печени: рандомизированное контролируемое исследование. Бесплатно. Радич. Биол. Med. 52 1658–1665. 10.1016 / j.freeradbiomed.2012.02.008 [PubMed] [CrossRef] [Google Scholar]
  • Loguercio C., Festi D. (2011). Силибин и печень: от фундаментальных исследований к клинической практике. World J. Gastroenterol. 17 2288–2301. 10.3748 / wjg.v17.i18.2288 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Макишима М., Окамото А. Ю., Репа Дж. Дж., Ту Х., Лернед Р. М., Лук А. и др. (1999). Идентификация ядерного рецептора желчных кислот. Наука 284 1362–1365. 10.1126 / science.284.5418.1362 [PubMed] [CrossRef] [Google Scholar]
  • Мейсон А., Лукетич В., Линдор К., Хиршфилд Г., Гордон С., Мэйо М. и др. (2010). Агонисты рецептора фарнезоида-x: новый класс для лечения пвц? международное исследование по оценке добавления int-747 к урсодезоксихолевой кислоте. J. Hepatol. 52 S1 – S2. 10.1016 / S0168-8278 (10) 60004-9 [CrossRef] [Google Scholar]
  • Мацубара Т., Фей Л., Гонсалес Ф. Дж.(2013). Передача сигналов FXR в энтерогепатической системе. Мол. Клетка. Эндокринол. 368 17–29. 10.1016 / j.mce.2012.05.004 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Ni X., Wang H. (2016). Силимарин ослаблял стеатоз печени за счет регуляции липидного обмена и окислительного стресса на мышиной модели неалкогольной жировой болезни печени (НАЖБП). Am. J. Trans. Res. 8 1073–1081. [Бесплатная статья PMC] [PubMed] [Google Scholar]
  • Поляк С. Дж., Ференци П., Павлоцкий Я. М. (2013). Гепатопротекторные и противовирусные функции компонентов силимарина при вирусной инфекции гепатита С. Гепатология 57 год 1262–1271. 10.1002 / hep.26179 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Правитт Дж., Абделькарим М., Стров Дж. Х. М., Попеску И., Дуэз Х., Велагапуди В. Р. и др. (2011). Дефицит рецептора фарнезоида X улучшает гомеостаз глюкозы в моделях ожирения на мышах. Diabetes Metab. Res. Сборка 60 1861–1871 гг. 10.2337 / db11-0030 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Raina K., Агарвал К., Агарвал Р. (2013). Влияние силибинина на клетки колоректального рака человека: нацеливание на активацию передачи сигналов NF-κB. Мол. Канцерогенный. 52 195–206. 10.1002 / mc.21843 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Руи Л. (2014). Энергетический обмен в печени. Компр. Physiol. 4 177–197. 10.1002 / cphy.c130024 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Salamone F., Galvano F., Cappello F., Mangiameli A., Barbagallo I., Ли Вольти Г. (2012). Силибинин модулирует гомеостаз липидов и ингибирует активацию ядерного фактора каппа B при экспериментальном неалкогольном стеатогепатите. Пер. Res. 159 477–486. 10.1016 / j.trsl.2011.12.003 [PubMed] [CrossRef] [Google Scholar]
  • Саллер Р., Мейер Р., Бриньоли Р. (2001). Использование силимарина при лечении заболеваний печени. Наркотики 61 2035–2063. 10.2165 / 00003495-200161140-00003 [PubMed] [CrossRef] [Google Scholar]
  • Саломоне Ф., Годос Дж., Зельбер-Саги С. (2016). Природные антиоксиданты при неалкогольной жировой болезни печени: молекулярные мишени и клинические перспективы. Liver Int. 36 5–20. 10.1111 / liv.12975 [PubMed] [CrossRef] [Google Scholar]
  • Шайк Ф. Б., Прасад Д. В., Нарала В. Р. (2015). Роль рецептора фарнезоида X в воспалении и разрешении. Inflamm. Res. 64 9–20. 10.1007 / s00011-014-0780-y [PubMed] [CrossRef] [Google Scholar]
  • Sinal C. J., Tohkin M., Miyata M., Ward J. M., Lambert G., Гонсалес Ф. Дж. (2000). Целенаправленное нарушение ядерного рецептора FXR / BAR нарушает гомеостаз желчных кислот и липидов. Ячейка 102 731–744. 10.1016 / S0092-8674 (00) 00062-3 [PubMed] [CrossRef] [Google Scholar]
  • Стикель Ф., Бринкхаус Б., Крахмер Н., Зейтц Х. К., Хан Э. Г., Шуппан Д. (2002). Антифибротические свойства растений при хронических заболеваниях печени. Гепатогастроэнтерология 49 1102–1108. [PubMed] [Google Scholar]
  • Тамайо К., Даймонд С. (2007). Обзор клинических испытаний по оценке безопасности и эффективности расторопши ( Silybum marianum [L.] Гертн.). Integr. Рак Тер. 6 146–157. 10.1177 / 1534735407301942 [PubMed] [CrossRef] [Google Scholar]
  • Тиндл Х. А., Дэвис Р. Б., Филлипс Р. С., Эйзенберг Д. М. (2005). Тенденции использования дополнительной и альтернативной медицины взрослыми в США: 1997–2002 гг. Альтерн. Ther. Health Med. 11 42–49. [PubMed] [Google Scholar]
  • Велусси М., Чернигой А. М., Ариэлла Д. М., Дапас Ф., Каффау К., Зилли М. (1997). Длительное (23 месяца) лечение антиоксидантным препаратом (силимарин) эффективно при гиперинсулинемии, потребности в экзогенном инсулине и уровнях малонового диальдегида у пациентов с циррозом и диабетом. J. Hepatol. 26 год 871–879. 10.1016 / S0168-8278 (97) 80255-3 [PubMed] [CrossRef] [Google Scholar]
  • Вороняну Л., Нистор И., Думеа Р., Апетрий М., Чович А. (2016). Силимарин при сахарном диабете 2 типа: систематический обзор и метаанализ рандомизированных контролируемых исследований. J. Diabetes Res. 2016 г. 5147468 10.1155 / 2016/5147468 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Вахи Г., ЛеБлан П. Дж., Хэй Дж. А., Фаут Б. Э., О’Лири Д., Кэрни Дж. (2011).Метаболический синдром у детей с нарушением координации развития и без него. Res. Dev. Disabil. 32 2785–2789. 10.1016 / j.ridd.2011.05.030 [PubMed] [CrossRef] [Google Scholar]
  • Ван Ю. Д., Чен В. Д., Ван М., Ю. Д., Форман Б. М., Хуанг В. (2008). Рецептор фарнезоида X противодействует ядерному фактору κB при воспалительном ответе печени. Гепатология 48 1632–1643. 10.1002 / hep.22519 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Westin S., Хейман Р. А., Мартин Р. (2005). FXR, терапевтическая мишень для желчных кислот и липидных нарушений. Mini Rev. Med. Chem. 5 719–727. 10.2174 / 1389557054553802 [PubMed] [CrossRef] [Google Scholar]
  • Ву К. Х., Хуанг С. М., Йен Г. К. (2011). Силимарин: новый антиоксидант с антигликационными и противовоспалительными свойствами in vitro и in vivo. Антиоксид. Редокс-сигнал. 14 353–366. 10.1089 / ars.2010.3134 [PubMed] [CrossRef] [Google Scholar]
  • Ян Ф., Хуан Х., Йи Т., Йен Й., Мур Д., Хуанг В. (2007). Самопроизвольное развитие опухолей печени при отсутствии рецептора желчной кислоты фарнезоида X рецептора. Cancer Res. 67 863–867. 10.1158 / 0008-5472.CAN-06-1078 [PubMed] [CrossRef] [Google Scholar]
  • Yang F., Xu Y., Xiong A., He Y., Yang L., Wan Y. J., et al. (2012). Оценка защитного действия Rhei Radix et Rhizoma против повреждения печени, вызванного α-нафтилизотиоцианатом, на основе метаболического профиля желчных кислот. J. Ethnopharmacol. 144 599–604. 10.1016 / j.jep.2012.09.049 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Zhang L., Wang YD, Chen WD, Wang X., Lou G., Liu N., et al. . (2012). Содействие регенерации / восстановлению печени рецептором фарнезоида X как в печени, так и в кишечнике мышей. Гепатология 56 2336–2343. 10.1002 / hep.25905 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]
  • Zhang Y., Lee F. Y., Barrera G., Lee H., Vales C., Gonzalez F. J. и др. (2006). Активация ядерного рецептора FXR улучшает гипергликемию и гиперлипидемию у мышей с диабетом. Proc. Natl. Акад. Sci. США 103 1006–1011. 10.1073 / pnas.0506982103 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Истории потери веса из расторопши

Польза от похудания расторопши не полностью подтверждена наукой. Расторопша должна оставаться добавкой для меня из-за лекарств, которые я принимаю от своего аутоиммунного заболевания, я должен поддерживать здоровье своей печени и помогать в ее удалении.

20 фунтов за 30 дней Истории успеха

Истории потери веса расторопши бесплатно HD обои были загружены администратором.Загрузите это изображение бесплатно в разрешении HD, выбрав "кнопку загрузки" ниже. Если вы не можете найти точное разрешение, которое ищете, выберите собственное или более высокое разрешение.

Не забудьте добавить в закладки истории похудения расторопши, используя Ctrl + D (ПК) или Command + D (macos). Если вы используете мобильный телефон, вы также можете использовать ящик меню из браузера. Будь то Windows, Mac, iOS или Android, вы сможете загружать изображения с помощью кнопки загрузки.

Экстракт расторопши содержит полезные для здоровья соединения, такие как силимарин.

Истории похудания расторопши . Если вы чувствуете, что расторопша стала причиной потери веса. Поддержка печени расторопши и. Вы, вероятно, слышали об использовании расторопши во многих программах по снижению веса.

Эта история успеха в похудении исходит от хрусталя. Забавные истории для порогов Амазонки. Вот 7 полезных свойств расторопши.

Найдите полезные обзоры клиентов и оценки в обзорах о расторопше пятнистой. Хотя расторопша является дополнительной и альтернативной медициной, которая использовалась в течение тысяч лет, вряд ли она приведет к значительному снижению веса.Расторопша помогает избавиться от лишнего веса.

К сегодняшнему выпуску дорогой марки у нас есть три части. У меня легкий вес, и я всегда был им. Всегда воодушевляет читать другие истории о похудании, потому что это помогает.

Остеопороз - это заболевание, вызванное прогрессирующей потерей костной массы. Это действительно работает. Сначала я расскажу о потенциально эстрогенных эффектах экстракта расторопши и обсудю, действительно ли.

Похудение расторопши помогает, потому что она помогает организму расщеплять жир.Было показано, что он улучшает здоровье печени, но помогает ли он похудеть. Какие традиционные истории говорят, были вызваны каплей.

Расторопша и потеря веса Пория Трава

Muscleblaze Расторопша 60 капсул без запаха

20 фунтов за 30 дней Истории успеха

Расторопша полезна Истории похудания

Обзоры Что вы едите в любом случае 9000 Мгновенная потеря веса Система расторопши 10 Снижение веса

Amazon Com Расторопша Расторопша Снижение веса Витамины Диетическое питание

Экстракт расторопши поддерживает здоровье печени Детоксикация помогает снизить уровень холестерина

Как Джон Фэгли обратил свой диабет, потребляя больше жира

Чай из расторопши с жиром

Польза для здоровья печени от похудания черного чертополоха

Истории похудания Кристал Павловски потерял 100 фунтов

Amazon Com Поддержка печени и похудание Расторопша

Расторопша и потеря веса Ez Slim Weight Loss Patch

Польза для здоровья печени расторопши и поддержка детоксикации печени

10 потенциальных преимуществ для здоровья от расторопши

Let S Talk Mthfr Удобно готовьте свой

30 преимуществ расторопши при поддержке Research Organifi

20-дневная формула детоксикации печени для пищеварения Детокс для печени Очищение от лишнего веса Расторопша пятнистая Одуванчик Протеаза артишока и фермент липазы

Полное руководство по добавке расторопши

Печень S Best Friend Natural Grocers

Amazon Com Расторопша Снижение веса Витамины Диетические

30 советов по снижению веса за 30 дней 26 Расторопша

Может ли расторопша помочь вам похудеть Мгновенно нокаут

Добавка Detox Supreme

7 научно обоснованных преимуществ расторопши

Natures Craft S Лучшая добавка для поддержки детоксикации печени с расторопшей 60 растительных капсул на основе молока

7 полезных свойств расторопши

Накорми свою печень расторопшей Энн Луиза Гиттлман

Есть ли связь между расторопшей и похуданием

Расторопша - лучший друг для здоровья современной печени

Расторопша помогает похудеть Истории

Почему гормоны и потеря веса Отзывы

Почему гормоны и потеря веса Вы не худеете Goop

Чай из расторопши

Есть ли связь между расторопшей и потерей веса

Как IN Избыточно похудевший вес очистил мою кожу от роста волос

Полное руководство по добавке расторопши

Положительные эстрогенные эффекты экстракта расторопши

Каковы побочные эффекты хорошего очищения печени

7 преимуществ для здоровья и использования молока Thistle Care2 Healthy

Ioth Silymarin Milk Thistle Powder

Есть ли у расторопши противопоказания Liversupport Com

Magazine Issues Techline Invasive Plant News

Starter Pack with Diet Capsules

Isain Milk Milk Milk Explist 9000 для собак Расторопша для сжигания жира и детоксикации

7 полезных свойств глутатиона

8 естественных добавок для похудания Healthbad

Weed Power Молочный чертополох Болезнь печени

30 советов по снижению веса за 30 дней 26 Молочный чертополох Healthista

Молочный чертополох Peterandjohn

30 советов по снижению веса за 30 дней 26 Молочный чертополох Youtube

Чистые органические капсулы для похудания из расторопши для печени Loss Non Gmo Без глютена Нет

Куркума Haldi для похудания Здесь S Как куркума может

Расторопша полезна для здоровья Побочные эффекты Дозировка

Силимарин Расторопша

Расторопша способствует детоксикации печени

Thistle

Ultra Colon Cleanse3 Супер бустер для бодибилдинга и здоровья

Расторопша может помочь защитить от подержанных сигарет

Влияние куркумы на потерю веса Vi tagene

Здоровая печень с экстрактом расторопши и его

Расторопша Национальные статьи по питанию

Расторопша пятнистая Различные уровни поддержки печени

Полное руководство по добавке расторопши

Расторопша противодействует кошкам

Снижает вес Aren T Losing

Куркума Haldi для похудения Вот как можно использовать куркуму

Рецепт смузи Green Power с расторопшей и алоэ вера

Можете ли вы очистить свою печень о методах детоксикации

Nature S Sunshine Добавки в таблетках из расторопши

TR 60 Таблетки

10 добавок, которые следует принимать после профилактики менопаузы

Силимарин 80

6 причин, почему расторопша пятнистая ood For Health

Puritan S Pride Of Milk Thistle 4 1 Экстракт 1000 Mg Силимарин 180 Softgels Бесплатная доставка

Lipochol Liver Cleanser 30 Day Detox Milk Thistle Silymarin Снижение веса Кожа Здоровье Здоровье Печени

Вы можете похудеть всего за один день до 2 фунта

Bff Challenge Pack с каплями

История похудания Бриджит С. при борьбе с менопаузой

Расторопша полезна для здоровья Побочные эффекты Дозировка

Расторопша плюс

Как быстро можно похудеть Mark S Daily Buy Apple

Управление весом Добавки Продукты Online Low

Proburst Milk Thistle Nutrabay Com

Как расторопша может помочь вашей тренировке Напитки для навеса

Лучшие добавки для похудения Четыре добавки Элементы в помощь

Позы йоги для увеличения веса Лучшие таблетки для набора массы

Снижение веса на 5 кг за 1 неделю с чаем с куркумой Рецепты для похудения с куркумой Детокс-чай Хинди

Экстракт расторопши пятнистой расторопши Silybum Marianum Silymarin

20 фунтов за 30 дней Успех Рассказы

Расторопша от прыщей Помогает ли расторопша от прыщей

Яблочный уксус с двойной силой элемент Swd036

Расторопша Надежная поддержка для исцеления здоровья в

Этот план диеты для детоксикации печени может помочь вам избавиться от жира для диеты

9000 Gmdiet Plan Twitter

Расторопша при заболевании печени кошек

Лучшие добавки для лечения гипотиреоза Pcos Путешествия и походы

Расторопша для лошадей Forageplus Whole Horse Health 90 003

Активная печень

Связано: Истории похудения расторопши.

14 Впечатляющие преимущества расторопши

Наиболее важные преимущества расторопши для здоровья включают в себя ее способность выводить токсины из печени, ускорять восстановление органов, замедлять прогрессирование некоторых видов рака, лечить грибковые инфекции и лечить похмелье. Он также защищает организм от побочных эффектов фармацевтических препаратов, замедляет развитие болезни Альцгеймера, снижает риск сердечных заболеваний и устраняет симптомы диабета.

Что такое расторопша?

Расторопша пятнистая, известная в науке как Silybmommarianum, - однолетнее цветущее растение с красновато-пурпурными цветками.Вы также можете знать расторопшу под любым количеством других названий, в зависимости от того, где вы находитесь в мире, включая чертополох марианский, средиземноморский, чертополох шотландский и другие. [1]

Это растение широко известно и высоко ценится благодаря мощным органическим компонентам, содержащимся в его семенах. Именно из семян расторопши получают экстракт, который содержит высокие концентрации силимарина, самого уникального и активного ингредиента экстракта. Экстракт также содержит различные жирные кислоты, в том числе линолевую кислоту.Хотя это растение когда-то было родным для южной Европы и некоторых частей Азии, теперь оно натурализовано во многих местах по всему миру.

Существует большое количество исследований, посвященных лечебным свойствам расторопши, многие результаты противоречивы или горячо обсуждаются. Все согласны с тем, что экстракт может оказать значительное влияние на функцию и здоровье печени, для чего это растение использовалось веками. [2]

Преимущества расторопши

Давайте подробнее рассмотрим некоторые из этих важных преимуществ расторопши для здоровья:

Защищает печень

Расторопша известна своим детоксикационным действием на печень благодаря своим флавоноидам. комплекс под названием силимарин.Исследование 2017 года подтверждает, что это может помочь ускорить процесс заживления в печени, устраняя большую часть ущерба от чрезмерного употребления алкоголя или другого вредного поведения печени, включая цирроз. Он также может предотвратить такие состояния, как синдром ожирения печени, желтуха и гепатит; однако необходимы дополнительные исследования для изучения терапевтического потенциала лекарственного растения. Согласно исследованию на животных, экстракт может помочь защитить печень, которая может быть легко повреждена чрезмерным использованием фармацевтических препаратов. [3] [4] [5]

Расторопша пятнистая используется для лечения алкогольной болезни печени и проблем с желчным пузырем. Фото: Shutterstock

Управляет диабетом

Комбинация антиоксидантов, жирных кислот и силибина в экстракте расторопши действительно может работать для регулирования уровня инсулина и поддержания даже уровня сахара в крови для людей с диабетом или подверженных риску его развития. [6]

Улучшает здоровье сердца

Экстракт расторопши содержит высокие концентрации полезных жирных кислот и омега-3, которые необходимы для поддержания здоровья сердца.Жирные кислоты омега-3 способны сбалансировать уровень холестерина в организме, что может предотвратить атеросклероз, тем самым снижая риск инсульта или сердечного приступа. [7]

Может иметь противоопухолевый потенциал

Согласно веб-сайту Cancer Research UK, экстракт расторопши может оказывать ингибирующее действие на рост раковых клеток и опухолей на коже, а также может помочь предотвратить раковый рост в простата, грудь и печень. [8]

Регулирует холестерин

Это противовоспалительное средство, помогает снизить уровень холестерина в организме, очищает кровь и предотвращает окислительный стресс.Присутствующий в его экстракте силимарин улучшает уровень липопротеинов низкой плотности (ЛПНП или плохой холестерин), общего холестерина и триглицеридов в организме.

Предотвращает образование камней в желчном пузыре

Очищая организм от метаболических отходов, расторопша помогает улучшить функцию желчного пузыря, почек и селезенки, тем самым предотвращая риск образования камней в желчном пузыре.

Уход за кожей

Расторопша пятнистая помогает уменьшить воспаление благодаря богатому содержанию антиоксидантов. Он также предотвращает старение кожи и способствует здоровому сиянию.

Потеря веса

Силимарин, присутствующий в расторопше, способствует снижению веса согласно исследованию, проведенному в 2016 году на мышах.

Улучшает здоровье костей

Расторопша помогает предотвратить потерю костной массы, вызванную дефицитом эстрогена. Он также улучшает здоровье костей и предотвращает риск остеопороза.

Лечит астму

Показано, что силимарин в расторопше, уменьшая воспаление в дыхательных путях, предотвращает симптомы аллергической астмы.

Повышает иммунитет

Расторопша повышает общий иммунитет и борется с инфекциями. Силимарин в нем также способствует образованию в организме глутатиона, который помогает бороться с окислительным стрессом, тем самым улучшая общее состояние здоровья организма.

Противогрибковая активность

Существуют определенные грибковые инфекции, которые, как было доказано, нейтрализует расторопша, и это, вероятно, связано с традиционным использованием расторопши в качестве средства от отравления грибами. Многие разновидности грибов опасны, и гриб «смертельная шапка» особенно токсичен, но его можно вводить для предотвращения смертности. [9]

Замедляет начало болезни Альцгеймера

Исследователи из Института исследований старения Бака, Новато, США, считают, что присутствие силимарина в расторопши может стимулировать когнитивные способности и открывать новые нервные пути, эффективно замедляя начало деменции и болезни Альцгеймера. [10]

Лечит псориаз

Силимарин, содержащийся в расторопши, помогает при лечении псориаза. Он помогает бороться с покраснением, зудом и толстыми пятнами на коже.

Использование

Для расторопши не существует предписанной дозировки, поэтому лучше использовать дозировку, указанную на упаковке.

Его можно использовать по-разному и в различных рецептах, включая следующие:

  • Корни иногда едят сырыми или вареными
  • Из побегов можно сделать что-то вроде спаржи
  • Листья можно использовать как замена шпината
  • Экстракт можно использовать для различных травяных и альтернативных лечебных средств
  • Он также доступен в виде чая

Побочные эффекты

Это не является обычно аллергенным веществом, хотя известно, что он вызывает следующее: [11]

  • Тошнота
  • Спазмы
  • Диарея
  • Проблемы с животом
  • Аллергические реакции
  • Взаимодействие с лекарствами
  • Слабость
  • Избыточный газ
расторопша, так как они находятся в близком родстве.Наконец, женщинам с дефицитом эстрогена или эндометриозом следует избегать этого экстракта, так как он может вызвать колебания уровня эстрогена.

С осторожностью рекомендуется кормящим и беременным женщинам.

Добавки: расторопша - Today's Dietitian Magazine

Апрель 2020 Выпуск

Добавки: расторопша
Брианна Тобрицхофер, MS, RD, LD
Сегодняшний диетолог
Vol.22, № 4, стр. 14

Хотя это, вероятно, безопасно, исследования по эффективности добавки для здоровья печени и других целей неоднозначны.

Расторопша пятнистая - лечебное средство на травах, которое тысячелетиями использовалось для лечения различных заболеваний, особенно заболеваний печени. Фактически, расторопша является наиболее часто используемой растительной добавкой в ​​Соединенных Штатах при проблемах с печенью.1

Интерес потребителей к этому популярному ботаническому продукту достиг пика в последние годы.Сторонники расторопши утверждают, что она полезна не только для здоровья печени, но и от предотвращения повреждения мозга до увеличения выработки грудного молока.

Есть ли правда в этих утверждениях? В этой статье обсуждается, что RD должны знать о расторопши, от ее потенциальной пользы для здоровья до инструкций по применению и возможных побочных эффектов.

Что такое расторопша?
Расторопша является производным расторопши пятнистой, Silybum marianum . Активные ингредиенты расторопши представляют собой группу растительных соединений, называемых силимарином, которые обладают несколькими антиоксидантными, противовирусными и противовоспалительными свойствами.2

Хотя расторопша произрастает в Средиземноморском регионе, ее применение при заболеваниях известно во всем мире. Произрастает в некоторых частях Европы, России, Азии, Африки и Австралии, а также в Северной и Южной Америке.1

Другие распространенные названия расторопши включают чертополох, святой чертополох и силимарин (в честь его наиболее известных растительных соединений). Пурпурные цветы колючего расторопши содержат молочно-белую жидкость, которую экстрагируют и используют в пищевых добавках.Добавки расторопши обычно употребляются перорально.1

Тенденция роста
Несмотря на то, что расторопша существует уже много веков, ее популярность в качестве пищевой добавки в последние годы возросла. Это часто объясняется тенденцией к «детоксикации» печени и более глубоким восприятием потребителями потенциальных преимуществ расторопши для здоровья.

Согласно отчету Research Report Insights, опубликованному в апреле 2019 года, продажи добавок расторопши вырастут на 6% в 2019 году.В 2018 году было продано около 890 тонн добавок расторопши, большая часть которых была закуплена в Северной Америке и Европе. Гелевые капсулы - самая популярная разновидность добавок расторопши, но они также доступны в виде жидкого экстракта и таблеток3.

Возможная польза для здоровья
Расторопша получила наибольшую известность благодаря своим предполагаемым защитным свойствам для печени. Исследования показали, что расторопша помогает уменьшить воспаление и повреждение печени, вызванное свободными радикалами.Он обладает способностью подавлять и ингибировать воспалительные цитокины и увеличивать выработку молекул, уменьшающих воспаление, таких как интерлейкин 10 и глутатион.2

В нескольких исследованиях основное внимание уделялось роли расторопши в лечении неалкогольной жировой болезни печени (НАЖБП). В одном исследовании у лиц с НАЖБП, которые принимали 600 мг расторопши ежедневно в течение 12 месяцев, были обнаружены более низкие уровни инсулина натощак, ферментов печени и других плазменных маркеров фиброза печени.2

Некоторые исследования отметили небольшое улучшение симптомов, лечения и выживаемости среди людей с гепатитом С, анемией Кули, раком печени и циррозом, вызванным алкогольной болезнью печени.1

Хотя исследования, проведенные в отношении расторопши и заболеваний печени, в некоторой степени обнадеживают, необходимы дополнительные исследования, прежде чем можно будет сделать вывод о его роли в здоровье печени. Нет убедительных доказательств того, что расторопша может предотвратить, вылечить или лечить заболевания печени.Также необходимы дополнительные клинические испытания, чтобы определить дозу и продолжительность лечения, необходимого для лечения заболеваний печени с помощью расторопши.

Есть некоторые свидетельства того, что расторопша полезна для других систем и состояний организма. Например, соединения расторопши могут улучшить контроль уровня сахара в крови и чувствительность к инсулину у людей с диабетом 2 типа. Недавний обзор и метаанализ пяти рандомизированных контролируемых исследований показали, что регулярное использование добавок расторопши было связано со значительным снижением уровня глюкозы в крови натощак и уровней HbA1c у 270 пациентов с диабетом.4 Однако качество рассмотренных исследований было низким, и необходимы дальнейшие исследования.

Несколько других небольших исследований на людях показали, что добавки с расторопшей могут помочь избавиться от угрей и увеличить выработку грудного молока у кормящих матерей.5,6 Также есть много анекдотических сообщений об использовании расторопши для лечения расстройства желудка, но исследования, лежащие в основе этих утверждений отсутствует.

Остальные исследования добавок к расторопше сосредоточены на результатах исследований на животных и in vitro.Некоторые из них предполагают, что антиоксидантные, противовоспалительные и противовирусные свойства расторопши могут оказывать противоопухолевое действие и помогают предотвратить побочные эффекты от методов лечения рака.7,8 Кроме того, экспериментальные исследования показывают, что расторопша может быть полезной для защиты от рака. остеопороз и возрастное снижение функции мозга 9-11

Дозировка
К сожалению, лучшая дозировка и продолжительность лечения с использованием расторопши неизвестны из-за ограниченного количества исследований.Пациенты должны поговорить со своим лечащим врачом для получения индивидуальных рекомендаций по использованию расторопши в зависимости от состояния их здоровья, лекарств, образа жизни и лечения.

Добавки на рынке содержат различные дозы расторопши. Инструкции по дозировке добавок различаются в зависимости от концентрации и предполагаемого использования, которые всегда должны указываться на этикетке добавки. Некоторые исследования показывают, что ежедневная доза от 140 до 420 мг экстракта расторопши обладает потенциальными преимуществами для контроля уровня сахара в крови, но правильная дозировка для других состояний или преимуществ, включая здоровье печени, неясна.12

Концентрация силимарина обычно указывается на этикетках добавок расторопши, которая зависит от марки. В настоящее время недостаточно исследований, чтобы определить, какая концентрация лучше всего подходит для людей, принимающих добавки расторопши.

Побочные эффекты
Добавки расторопши хорошо переносятся большинством людей при приеме внутрь. Имеются минимальные сообщения о побочных эффектах, которые обычно ограничиваются желудочно-кишечными жалобами.2

Важно отметить, что люди с аллергией на растения из того же семейства, что и расторопша, такие как амброзия, хризантема, календула и маргаритка, подвержены риску возникновения аллергической реакции при употреблении добавок.Кроме того, людям с диабетом и чувствительными к гормонам состояниями следует с осторожностью относиться к расторопше, так как она может иметь эстрогенный эффект и может снижать уровень сахара в крови.1

Беременным женщинам рекомендуется избегать приема добавок расторопши, поскольку их безопасность не подтверждена в этой группе населения. То же самое верно и для людей с ослабленной иммунной системой.1

Хотя добавки расторопши в целом считаются безопасными, клиенты всегда должны проконсультироваться со своими поставщиками медицинских услуг, прежде чем пробовать их.Кроме того, следует избегать внутривенного лечения расторопшей и любых других добавок, кроме пероральных, поскольку их безопасность неизвестна.

Рекомендации для клиентов
Несмотря на ограниченные данные о пользе расторопши для здоровья, неизбежно то, что заявления о ее применении будут продолжать привлекать потребителей. Таким образом, РД должны быть подготовлены с соответствующими рекомендациями, чтобы консультировать своих пациентов о том, как их безопасно использовать.

В качестве в целом безопасной добавки врачи могут давать обоснованные рекомендации пациентам, принимающим добавки расторопши, на основе приведенных выше доказательств.Хотя нет убедительных научных доказательств предполагаемой пользы для здоровья расторопши, она показывает потенциал в ее способности поддерживать функцию печени и помогать в улучшении других заболеваний.

Если пациенты предпочитают принимать добавки с расторопшей, важно, чтобы они соблюдали полноценную питательную диету, здоровый образ жизни и адекватную медицинскую помощь. Добавки расторопши не должны заменять какие-либо из последних.

RDs также должны быть подготовлены с рекомендациями для брендов добавок расторопши, которые являются высококачественными и фармацевтическими, что означает, что они были оценены третьей стороной, такой как ConsumerLab.com или Фармакопеи США, чтобы проверить точность заявленного содержания.

- Брианна Тобрицхофер, MS, RD, LD, является старшим менеджером службы питания Open Arms of Minnesota. Она также предоставляет услуги внештатного писателя через свой бизнес Bri Toby Nutrition Company.


Список литературы

1. Расторопша пятнистая. Веб-сайт Национального центра дополнительного и интегративного здоровья. https://nccih.nih.gov/health/milkthistle/ataglance.htm. Обновлено в сентябре 2016 г.Доступ 4 января 2020 г.

2. Ачуфуси ТГО, Патель РК. Расторопша . Остров сокровищ, Флорида: StatPearls Publishing; 2019: 1-8.
3. Исследование мирового рынка добавок расторопши, 2019-2027: осведомленность потребителей о спросе на профилактическое медицинское топливо. Веб-сайт Research Report Insights. https://www.researchreportinsights.com/report/91/milk-thistle-supplements-market. Опубликовано в апреле 2019 г. Проверено 3 января 2020 г.

4. Вороняну Л., Нистор И., Думеа Р., Апетрий М., Чович А.Силимарин при сахарном диабете 2 типа: систематический обзор и метаанализ рандомизированных контролируемых исследований. J Диабет Res . 2016; 2016: 5147468.

5. Ши Мортеза М., Хаяти З., Намази Н., Абдоллахимайд Ф. Эффективность и безопасность перорального силимарина по сравнению с пероральным доксициклином и их комбинированной терапией при лечении вульгарных угрей. Дерматол Тер . 2019; 32 (6): e13095.

6. Ди Пьеро Ф, Каллегари А, Каротенуто Д, Тапиа ММ.Клиническая эффективность, безопасность и переносимость BIO-C (микронизированного силимарина) в качестве галактагога. Acta Biomed . 2008; 79 (3): 205-210.

7. Polachi N, Bai G, Li T, et al. Модулирующие эффекты силибинина в различных сигнальных путях клеток против заболеваний печени и рака - всесторонний обзор. Eur J Med Chem . 2016; 123: 577-595.

8. Сигель А.Б., Стеббинг Дж. Расторопша пятнистая: потенциальные ранние семена. Ланцет Онкология .2013; 14 (10): 929-930.

9. Мохд Фози Н.Ф., Мазлан М., Шид А.Н., Иса Наина М. Расторопша пятнистая: потенциальное средство против остеопороза и лечения переломов в будущем. Curr Drug Targets . 2013; 14 (14): 1659-1666.

10. Абдул Джалил М.А., Шуид А.Н., Мухаммад Н. Заживление переломов при остеопорозе: потенциальное использование лекарственных растений из тропиков. Curr Drug Targets . 2013; 14 (14): 1651-1658.

11. Galhardi F, Mesquita K, Monserrat JM, Barros DM.Влияние силимарина на биохимические параметры окислительного стресса в мозге старых и молодых крыс. Food Chem Toxicol . 2009; 47 (1): 2655-2660.

12. Расторопша пятнистая. Сайт Drugs.com. https://www.drugs.com/npp/milk-thistle.html. Обновлено 1 марта 2019 г. Проверено 3 января 2020 г.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

2021 © Все права защищены.