Разное

Чай кудин отзывы: Зеленый чай Конфуций Чай Кудин

Содержание

Чай кудин — польза и вред, отзывы

И снова мы приветствуем Вас, дорогие любители хорошего чая, на нашем сайте, на этот раз для того, чтобы рассказать про чай Кудин или, как его еще называют – «Кхудин». Названия у чая китайское и если его перевести, то получится словосочетание «горькая трава».

Как следует из его названия, напиток относят к горьким чаям (Кху Ча), несмотря на то, что фактически к чаем он не является, так как его приготавливают вовсе не из листов чайного дерева, а из листьев падуба парагвайского.


Полезные свойства чая Кудин

Напиток обладает рядом целебных свойств. Во-первых, он улучшает работу пищеварительной системы, что немало важно, ведь мы не всегда едим только полезные продукты. Да и тем, кто полностью перешел на здоровое питание такая профилактика не повредит.

Во-вторых, кудин приводит в норму артериальное давление.

В-третьих, с его помощью можно понизить содержание сахара в крови, что в целом будет полезным для каждого. В дополнение можем перечислить такие свойства напитка, как жаропонижающее и мочегонное. Они, несомненно, играют важную роль, особенно мочегонное, ведь, как вы знаете, этот процесс помогает высвободить токсины из организма.

Так же кудин является природным антиоксидантом, нормализует углеводный и липидный обмен. Есть предположения о том, что отвар этого напитка останавливает кашель, благоприятствует удалению флегмы и препятствует образованию раковых опухолей. И считается, что регулярное употребление этого чая защищает от радиации.

Но это все из уровня биологии, а на уровне обыденного сознания напиток дарит заряд бодрости, поднимает жизненный тонус и просто освежает! Разве не эти три компонента все мы ждем от чаев? Кстати, известно, что китайская медицина славится во всем мире, так вот китайские врачи любят Кудин за то, что он помогает поддерживать функцию сердца.


Приготовление чая Кудин

Да, сейчас переходим к практической части. В принципе тут нет ничего сложного, приготавливается Кхудин точно так же, как и чай. Берется сухая заварка, которую заливают водой и, определенное время настаивают.

Самое важное, на что следует обратить внимание – это температура воды. Для полного раскрытия вкуса нужно придерживаться следующих цифр.

Если вы для заварки используете воду с температурой 50-60 градусов, то вкус напитка окажется тонким и благородным, если же вы используете воду с температурой около 100 градусов, то ждите от напитка горечь полыни.

Да, немногие знают, что на вкус может повлиять температура воды, но, как вы можете видеть здесь, да и проследить на практике, это имеет место быть. Самого же Кудина не стоит брать слишком много, для заваривания на одного человека вполне хватит

одной или двух иголок.

Иголки – это форма листьев напитка. В целом, теперь вы знаете все то, что полезно знать об этом напитке. Можем лишь заметить, что вкус у него довольно специфический, и невозможно сказать, что это тот напиток, который нравится всем без исключения.

Многие находят чай Кудин весьма интересным, а есть и те, кто пьет его ради поддержания своего здоровья. Вам же мы желаем познать полноту вкуса данного напитка и насладиться им сполна!

Приятного чаепития!

(с) Интернет магазин чая InTea.ru

Следующая статья – Все самое интересное про Белый Пуэр!

]]> ]]>

полезные свойства и заваривание ❧ Подборка кудина в NewTea

Зеленые и красные чаи, пуэры и улуны сегодня популярны не только в Китае, но и среди ценителей этого напитка во всем мире. А вот другая китайская разновидность чая – кудин – известна куда меньше. Между тем, о целебных свойствах «горькой слезы» в Поднебесной знали еще два тысячелетия назад.

Чай молодости для любимой

Легенда гласит, что китайский император Тяньбао династии Тан подарил сосуд с чаем своей невесте, чтобы сохранить молодость и красоту избранницы. Говорят, кудин невесте понравился. О том, как сложились отношения пары, история умалчивает, а вот напиток стал в Китае очень популярным.

Неискушенные люди не отличат кудин от зеленого чая, ведь внешне заварка очень похожа на сухие чайные листья. Однако для приготовления настоя используются молодые листья падуба широколистного. Урожай вручную собирают весной, листочки сушат на солнце, а потом скручивают, тоже руками, а не машинным способом. Благодаря естественным процессам изготовления чая в листьях сохраняются все полезные вещества.

Так весело происходит сбор падуба в Поднебесной.

Секрет благотворного действия кудина

За характерный привкус и терпкость чай называют «горькой слезой», но ценится кудин больше за целебные свойства. По силе воздействия на организм напиток приравнивается к фитолекарствам. В плане пользы кудин на голову превосходит зеленые чаи.

Кудин продается в каждом чайном магазине Китая. Но это не чай. Его делают из молодых…

Состав напитка

Сила кудина – в редком сочетании полезных элементов. В высушенных листьях падуба содержатся:

  • витамины группы В, А, D, РР и Е;
  • флавоноиды: концентрация в 10 раз выше, чем в зеленых сортах чая;
  • эфирные масла;
  • аминокислоты;
  • минералы и микроэлементы;
  • танин.
Эти листики бережно сворачиваются в трубочками сборщицами. И снова распускаются уже в кипятке.

Полезное действие

Кудин пьют для улучшения самочувствия и при разных заболеваниях.

Как влияет чай из падуба на организм:

  • укрепляет сердце и стенки сосудов, препятствует появлению тромбов в крови;
  • тонизирует и снимает усталость;
  • нормализует уровень сахара в крови, поэтому показан диабетикам;
  • повышает иммунитет и сопротивляемость организма инфекциям;
  • мягко повышает артериальное давление, рекомендуется при гипотонии;
  • улучшает память и концентрацию внимания;
  • регулирует обменные процессы, способствует похудению;
  • помогает избавиться от простуды, понижает температуру;
  • чистит печень, выводит токсины и тяжелые металлы.

Несмотря на целый список «плюшек», употребление кудина способно произвести обратный эффект. Нежелательно пить этот чай беременным, ведь напиток повышает давление, что опасно во втором триместре.

Нюансы заваривания

Кудин похож на зеленый чай, но в приготовлении есть отличия. Дозировка заварки – по количеству стрелок (скрученных листочков). На одну порцию берут половину стрелки.

Заваренный кудин. Необычный мед из «Горькой слезы». Прекрасно дополнит напиток.

Шикарная версия нашего хита EC-21. Более практичен, чем его хитовый родственник. Черн…

Температура воды для заваривания должна быть не выше 60°С. Настой выдерживают 30 сек. и сразу же разливают в чашки. Если передержать, напиток получится слишком горьким. Одна порция заваривается до 5 раз.

Чай кудин – напиток, целебные свойства которого люди используют уже не одно тысячелетие.

полезные свойства китайского чая, как правильно заваривать, польза и вред, противопоказания, как пить, горькая слеза, зеленый для похудения, иглы кудина

Чай Кудин — способ жить долго и счастливо. Жители Китая славятся долголетием: в стране этот напиток на протяжении двух тысяч лет используют в качестве лекарственного средства. В период холодов при гриппе, простуде вместо таблеток и порошков пьют целебный настой.

Чай Кудин — универсальный помощник для поддержания организма при сахарном диабете, гипертензии, нарушении обмена веществ и других заболеваний. Натуральное происхождение лечебного напитка вызывает доверие в большей степени, чем некоторые известные синтетические препараты.

Известный вид Кудин чая собирают вручную с сорта Падуба на юге Китая,  чаще всего на острове Хайнань и в провинции Гуанси. После сбора листья сворачивают в палочки 5-7см длиной, веретена и просушивают. Крупные побеги подвергаются прессованию и копчению. Способ обработки помогает длительное время, без потери качества, хранить сырье.

Интересный факт. Падуб— низкорослое дерево с широкими, напоминающие дубовые, листьями. Растет в Китае горных районах с повышенной влажностью. Не всегда желающие туристы могут попасть на плантации растения. Дорога к местности  труднопроходима.

Но больше всего ценится лист шуй сю, который собирают ранней весной, отрывать желательно молодой верхний побег. Мелкие почки считаются мощными источниками здоровья. Существует поверье: китайский чай Кудин был доставлен наследником императорской семьи для избавления от всех болезней. Целительное снадобье могли пить только представители высших социальных слоев.

Внешний вид сухого листа Кудина напоминает сорт зеленого чая. Но похожи они только внешне в высушенном состоянии: свойства напитков различаются. Некоторые специалисты не называют отвар листьев падуба чаем. Часто зеленый Кудин выдают за молодой зеленый чай.

Химический состав, калорийность, микроэлементы и витамины чая

Вкус напитка, вяжущий, с тонким ароматом трав, оставляет во рту небольшую горчинку, которая переходит в сладость. Неслучайно в переводе Кудин означает «горькая трава», название напиток получил от китайского «kuding cha».

Интересно. По одной из легенд девушку, которая занималась сбором целебного растения, отправили к императору в качестве наложницы. Бедная красавица не захотела довольствоваться жизнью в гареме: сбросилась с высокой горы и разбилась насмерть. Капельки крови несчастной попали на зеленые побеги китайского чуда-лекаря. Поэтому побеги сменили цвет на красный, вкус напитка  стал более терпким. Так чай Кудин получил название «горькая слеза».

Калорийность ароматной палочки небольшая:16 ккал,  это равно количеству калорий в одной шоколадной конфетке. Кроме этого у листьев богатый состав: трава содержит около 18-ти наименований аминокислот.

Также присутствуют вещества:

  • водорастворимые витамины: C, B1(тиамин) и В2;
  • жирорастворимые: Е, К, D.
  • минералы: кальций и калий, фосфор, железо, фтор, магний;
  • микроэлементы: кремний, хром, селен;
  • эфирные масла, придающие напитку аромат;
  • дубильное вещество теотанин.

Справка. Содержание антиоксидантов в чае Кудин в 10 раз больше, чем в зеленом чае.

Полезные свойства чая

Разгадка секрета напитка для продления молодости и здоровья— целый букет необходимых организму микроэлементов и минералов.

Отвар обладает рядом полезных свойств:

  • общеукрепляющее;
  • жаропонижающее;
  • противоспалительное;
  • мочегонное;
  • противовирусное;
  • разжижает кровь;
  • помогает восстановить обмен веществ.

Действие натурального доктора необходимо взрослым для регулирования уровня сахара в крови, избавления от головных болей. Китайский чай помогает в восстановлении функций печени и стимулирует функции нервной системы. Активизирует работу желудка и кишечника, избавляет от изжоги, облегчает похмельный синдром и избавляет от перепадов настроения в период гормональных изменений организма. Избавит женщин от периодических болей в критические дни.

Неоценима польза настоя падуба для пожилых людей: Кудин поможет привести давление в норму, значительно улучшить работу мозга и память. Тем самым снизит риск появления инфаркта, инсульта, острой сердечной недостаточности, гипертонии. Употребление настоя из листьев падуба сделают человека бодрым, активным, а мысли— ясными. При приеме повышается степень концентрации внимания: это особо актуально в пожилом возрасте. Чай применяют также в лечении глазных заболеваний.

Детям в сезон простуд дают китайский чай для профилактики респираторных заболеваний, аскорбиновая кислота в составе заварки сокращает продолжительность гриппа и ОРВИ. В лечении простуды отвар используют для снижения температуры тела, при лечении ларингита и фарингита, снимает красноту глаз. Удивительно, сколько уникальных свойств собрано в одном растении. В Китае напиток называют лекарством от 100 недугов. Напиток и расслабляет мышцы и тонизирует организм: поэтому может применяться во многих случаях.

Как правильно заваривать и пить

Для превращения листочков в лекарство недостаточно просто купить  заготовку для настоя. Важно правильно заварить Кудин: подготовить воду не выше 60°С-70°С для молодых побегов и 80°С для взрослых скрученных листьев.

Первый вариант— метод пролива

Горсть от 3 до 5 г молодых побегов заливают горячей водой и сливают. Крупное веретено из падуба кладут в расчете— 0,5-1палочку на стакан воды, первую заварку убирают. Так можно уберечь организм от попадания инфекции. Сборка идет вручную, траву нужно очистить от грязи и пыли. Китайский чай очень нежный, и быстрый многократный пролив поможет сохранить целостность листа и аромат. Дополнительное заваривание необходимо также для устранения сильного терпкого вкуса: можно регулировать степень горечи по собственным предпочтениям. Каждая следующая заварка будет слабее. Заливать водой можно сырье до 5 раз.

Время каждой заварки нужно увеличивать: от 1 до 2 мин. Залить в первый раз, слить. Добавить воды во второй раз, подождать минуту, убрать жидкость. После следующей заливки ждать 2мин.

Можно брать меньшее количество сухой смеси растения либо кусочек «веретена» и подливать столько жидкости, сколько необходимо конкретному человеку. Например, берут кончик палочки и заливают четвертью стакана воды.

Второй вариант—метод настоя

Так же соблюдая соотношение заготовки и воды, температурного режима, необходимо выполнять правильную заварку Кудина:

  1. Залить сырье жидкостью.
  2. Слить первую порцию воды.
  3. Добавить горячую воду еще раз.
  4. Дать чаю настояться.

Настой не заваривается, как обычный чай. Не стоит применять кипяток и ждать долгое время для получения готового напитка. Листики очень быстро раскрываются в воде под действием высокой температуры. А настой палочки падуба становится очень горьким при длительной выдержке.

Интересно. В Китае чай обычно заваривается в стакане для того, чтобы виден был «танец чаинок» и цвет настоя.

Как пить китайский Кудин: небольшими глотками, не смешивать с лимоном, молоком и другой едой. Оптимальное время приема настоя: через час после принятия пищи, в зависимости от показаний можно принимать и за час до еды.  Важно относиться к напитку как к лекарственному средству и не превышать объем: в день пить 2-3 чашки чая. В охлажденном виде выпить Кудин разрешается, но держите приготовленный настой больше 3 часов, исчезает польза напитка.

Особенности применения напитка

В народной медицине целебный отвар падуба применение чая важно для восстановления потенции и для замедления процессов старения. Используют свойство горькой травы тонизировать организм. Горький Кудин—практичное проверенное средство для лечения кашля. Помогает справиться с последствием радиационных воздействий.

В косметологических процедурах прибегают к целительной горечи для регенерации кожного покрова. Из  приготовленного настоя делают кубики льда, протирают кожу лица, шеи и декольте. Скрабирующее средство из измельченных листьев чая с солью прекрасно увлажняет и подтягивает.

В борьбе с лишним весом – хорощий помощник. За основу берется свойство чая снимать отеки и выводить из организма шлаки. Для похудения заваривают зелень через 40-50 мин после еды, принимают не более одного стакана целебного настоя. Трава поможет усвоению пищи и ускорит обмен веществ.

Возможный вред и противопоказания

Запрещено пить чай Кудин при беременности и грудном вскармливании. Бодрящее действие напитка обусловлено наличием в нем кофеина. Активная стимуляция психической деятельности нежелательна для сохранения здоровья будущей матери и ребенка.

По отзывам специалистов, отвар не рекомендуют пить детям младше 12 лет. И при настаивании чая дают совет, не делать слишком насыщенный напиток: ребенок может оказаться от чая из-за горького вкуса.

Нужна консультация врача при мочекаменной болезни и нарушении оттока желчи. После трансплантации органов нежелательно употреблять лечебный настой китайского чая. Артериальная гипертония – заболевание, при котором нельзя пить китайское средство из побегов и листьев падуба.

Ценители культурных традиций Поднебесной знают, что настой из побегов лечебного падуба — это не чай в ботаническом смысле слова. Иголки Кудина обладают травяным ароматом и только внешне напоминают чайные листики. Из-за цвета многие называют китайский чай  разновидностью зеленого чая.

Важно использовать хорошо просушенное сырье, заваривать и пить отвар в рекомендуемых дозах. При серьезных случаях заболеваниях и аллергических реакциях на настой необходимо вовремя обратиться к специалисту.

Чай кудин для похудения – делюсь опытом

Чай кудин попал ко мне случайно. Но кудин – качественный, из авторитетной пекинской чайной лавки, в герметичной, красивой зелено-золотистой упаковке с китайскими иероглифами, золотым тиснением медалей и наград сорта. 200 грамм плотно скрученных коричнево-зеленых спиралек стоили достаточно дорого – 150 $ (в Китае!).

К тому времени я много чего знала об этом напитке, поэтому заваривала с осторожностью – пол спиральки на 400-граммовую чашку. При температуре воды – около 90°С (короткий период, когда «нити жемчуга» переходят в «шум ветра в соснах»), заваренный, в выбранной мной пропорции, кудин обладал приятной горечью, сладковатым послевкусием и, что сразу обратило на себя внимание, — создавал ощущение сытости. Все, кого я угощала кудином, отмечали эти три особенности кудина.

Но по-настоящему я «подружилась» с этим чаем, когда оказалась на некоторое время одна дома, и мне было лениво ходить за покупками, готовить что-либо, и, вообще, заходить на кухню не хотелось. Пила себе кудин и занималась разными делами. И только на третий день обратила внимание, что я, кажется, ничего не ела. Но есть, при этом, не хотелось, и чувствовала я себя отлично.

Я нигде не нашла противопоказаний к чаю кудин, поэтому, вдобавок к двухразовому питанию, добавила кудин и продолжала, заваривая его не слишком круто, пить целый день. Т.е. половину спиральки заливала горячей водой раз пять-семь в течение дня. Надо отметить, что интенсивность горечи оставалась прежней и своего цвета, раскрывшийся лист кудина, не менял.

Выводы опыта похудения на кудине:

  • Вес на кудине сбросить можно, т.к. кудин настолько богат микроэлементами, витаминами, белками, аминокислотами и пр., что сам по себе представляет полезную и легкую пищу.
  • После чашки кудина остается чувство сытости.
  • Поскольку кудин не пьют с сахаром и сладким, быстро отвыкаешь от лишних углеводов.
  • Длительное употребление кудина позитивно сказывается на самочувствии, стабилизируется ровное состояние работоспособности и активности.
  • Кудин можно использовать и, как средство за ухода за кожей. Последняя заливка – великолепный тоник для лица. Никакой химии. Успокаивает раздражение, стягивает поры, увлажняет, нормализует работу сальных желез.

Я не ставила глобальной задачи – сбросить вес. Но так случилось, что он сам сбросился. Правда, в спортзал я хожу, чистую воду пью, жирное и жаренное не ем уже давно. Теперь еще вот кудин добавился.

Чай Кудин: 10 самых важных фактов

Чай кудин. Все о чае Кудин здесь. 

Какие полезные свойства у чая кудин?

Где купить кудин?

Как заваривать кудин?

Стоит ли пить кудин для похудения?

Горький ли чай кудин?

Как пить кудин?

Кудин (ку дин) – это вовсе не чай, хотя его можно найти практически в любом чайном магазине. Здесь мы собрали самые интересные факты об этом напитке. Теперь Вам не надо собирать информацию кусочками по интернету. Все здесь!

1.Производится кудин из листьев вечнозеленого субтропического растения под названием Падуб широколистный (llex latifolia). В китайском словаре падуб значится: ???, k?d?ngch?. Кудин в переводе с китайского означает «горькая трава».

2.Падуб произрастает преимущественно в южных провинциях Китая, на влажных, тенистых склонах гор, а также в смешанных лесах по берегам рек. Это невысокое, крепкое деревце с толстыми гладкими ветвями и крупными зелёными листьями с глянцеватым блеском. Цветы падуба мелкие, желтоватые, образуются в пазухах листьев весной, ягоды небольшие, круглые, желтого, оранжевого или красного цвета, созревают осенью и могут сохраняться на дереве всю зиму.

3.Падуб издавна ценился за свои декоративные и целебные качества. Им украшали дома в Древнем Риме в дохристианскую эпоху, а впоследствии падуб (или остролист) стал, наравне с омелой, символом Рождества. Друиды считали падуб символом солнца, а североамериканские индейцы готовили противоядия из листьев и черенков падуба чайного (Ilex vomitoria).

4.Сырьем для небезызвестного напитка матэ также служит один из видов падуба – падуб парагвайский (Ilex paraguariensis). Матэ готовят из его высушенных, измельченных листьев и молодых побегов.

5. Полезные свойства чая кудин. История применения кудина как лекарства в Китае насчитывает не одно столетие.

Кудин (или кхудин) китайцы относят к горьким чаям, кху ча. Горький вкус в традиционной китайской медицине соотносится с энергией инь, огнем, сердцем и тонким кишечником. Считается, что горький вкус устраняет излишний жар и огонь, применяется для лечения кашля и одышки, при заболеваниях желудка и кишечника, сопровождающихся тошнотой, рвотой и запорами. Также горечь способствует устранению застоя энергии (ци) в организме.

Проще говоря, чай ку дин обладает общеукрепляющим, тонизирующим, жаропонижающим, противовоспалительным, детоксикационным, диуретическим действием. Кроме того, кудин нормализует артериальное давление, углеводный и липидный обмен и способствует похудению, а еще обладает противоопухолевым эффектом.

6.Собирают кудин только вручную, небольшими партиями, весной. Затем сырье скручивают, прокаливают и сушат на солнце.

7.Кудин бывает скрученный, спиральный, связанный, листовой и даже прессованный.

8.Высший сорт чай кудин – Кудин Шуй Сю – производится из мелких молодых листочков, собранных на Желтой горе (Хуан шань) в провинции Сычуань. Именно его поставляли к императорскому двору.

9. Как пить и как заваривать чай Кудин? Кудин – отличное профилактическое средство, однако пить часто его не стоит, достаточно заваривать 2-3 раза в неделю, но заваривать правильно, чтобы не получить напиток полынной горечи.

Оптимальная температура воды – 80 градусов, лучше всего заваривать чай ку дин проливом, 1-2 иголочки на гайвань или чайничек. Первую заварку сливать не обязательно, но желательно, настаивать несколько секунд, увеличивая время по мере остывания воды. Кудин также можно заваривать в большом чайнике (3-4 иголочки) или просто в кружке (достаточно 1 иголочки). Главное – соблюсти температурный режим и не передержать заварку. Цвет готового настоя кудина желтовато-зеленый, аромат тонкий и благородный, во вкусе присутствует горечь и некоторая терпкость, послевкусие неизменно сладкое. Выдерживает многократное заваривание.

Получить подробную инструкцию с фотографиями

10. К сожалению, чай кудин частенько становится жертвой предубеждения. Многие, неправильно заварив его при первом знакомстве, более не желают это знакомство продолжать, а зря: кудин – отличный помощник в борьбе с целым спектром заболеваний, он наполняет тело легкостью, а сознание – ясностью. А еще кудин хорош в качестве добавки к шу пуэру.

 

 

как заваривать, польза и вред

С китайского название «кудин» так и переводится — «горькие гвозди». Неудивительно, ведь горечь – первый вкус, который мы чувствуем, когда делаем глоток этого чая. Не всякий сумеет распробовать кудин с первой (и даже с десятой) попытки. Несмотря на это, он считается одним из самых ценных напитков, дарующих крепкое здоровье и долголетие.

Помимо сильной иммуномодулирующей функции, кудин обладает поистине императорским набором полезных свойств

Говорят, что знаменитый китайский чай кудин стал таким, каким мы его знаем, в связи с трагической историей, детали которой давно уже стерлись в веках. Но если в двух словах, то это была история прекрасной девушки, что жила в провинции и собирала листья падуба для чая. Ее красота привлекла внимание местного чиновника, решившего, что девушка станет отличным подарком императору, и сборщица чая оказалась обречена на судьбу наложницы. Не желая мириться с этим, девушка сбросилась со скалы в том самом месте, где обычно собирала листья. Говорят, капли ее крови попали на кусты падуба и окрасили его почки в яркий красный цвет, а самим листьям подарили тот особенный горький вкус, который известен нам сегодня.

Падуб широколистный. Источник: greeninfo.ru

Что такое кудин?

Многие полагают, что кудин – один из сортов китайского чая, но это не так.

Практически весь китайский чай производится из листьев и/или почек растения камелия синенсис путем их ферментации. Кудин же представляет собой напиток из листьев падуба широколистного. Его парагвайский родственник служит основой для чая мате. Только у мате вкус нежный и сладковатый, а кудин известен своей яркой горечью.

Собирают листья падуба широколистного на склонах гор и в лесах китайских провинций Фуцзянь, Юньнань, Хэнань и Сычуань. А продается этот растительный чай чаще всего в виде тонких скрученных вручную «гвоздиков», реже бывает в спиралях, связанном, а также в рассыпном виде.

Несмотря на то, что кудин не является чаем в классическом понимании этого слова, он, как и листья камелии синенсис, содержит кофеин. Это важно помнить, поскольку обычно травяные чаи не имеют кофеина в своем составе, и их можно пить в любое время дня. С кудином все немножко иначе – он способен «зарядить» не хуже кофе, а потому с ним стоит быть осторожней.

Поклонники кудина сравнивают его вкус с грейпфрутом

Наш эксперт-титестер Наталья Прохоренко сравнивает вкус кудина со вкусом грейпфрута:

Сначала ты ощущаешь только горечь, но в послевкусии оказывается гораздо больше интересных оттенков, включая нежную тонкую сладость.

Как заваривать кудин и когда лучше пить?

Напиток допускает разные варианты приготовления, не утрачивая своих полезных свойств, но оптимальным считается заваривание по принципу зеленого чая: промытые кипятком листья (1 ч.л./1 «гвоздик» на 200-250 мл) следует залить водой около 80-85 градусов и настаивать не более 3 минут. Первую заварку лучше держать не дольше 1 минуты, затем увеличивать временной интервал. При таком подходе чай получается более нежным и менее горьким. Многие любители кудина утверждают, что самое трудное – поймать тот момент, когда полезные свойства листа уже перешли в настой, а сильная горечь – еще нет. Мы рекомендуем начинать с нескольких секунд (10-20), постепенно позволяя чаю настаиваться подольше.

Листья кудина выдерживают до 5 заварок. Не рекомендуется запивать этим напитком еду.

Наш эксперт советует употреблять кудин в чистом виде только в том случае, когда вам нужна «скорая медицинская помощь» – например, в начале простуды или при высокой температуре.

Когда я чувствую, что заболеваю или уже заболела, я завариваю кудин. Эффект, конечно, отличается от того, который дают антибиотики или жаропонижающее (когда выпил – и сразу хорошо), но в целом, если организм приучить к такому лечению, оно отлично действует. Однако с обычными лекарствами кудин стоит сочетать с осторожностью.

Если же у вас нет необходимости разом получить большую порцию полезных веществ, которые содержатся в этом напитке, лучше просто добавлять «гвоздики» кудина к другим чаям, в идеале – к пуэру.

Кстати еще одна легенда про кудин гласит, что рецепт этого напитка другой китайский император подарил своей возлюбленной в качестве эликсира молодости и здоровья. И отличный подарок ведь!

Интересное сочетание: пуэр и палочка кудина

Польза и вред чая кудин

Помимо сильной иммуномодулирующей функции, кудин действительно обладает поистине императорским набором полезных свойств. В том числе он:

  • Повышает жизненный тонус
  • Предотвращает образование тромбов и разжижает кровь
  • Действует как противовоспалительное и обеззараживающее средство
  • Имеет жаропонижающее действие
  • Используется для лечения кашля и катара верхних дыхательных путей
  • Улучшает пищеварению, уменьшает газообразование
  • Стимулирует работу сердечно сосудистой системы и укрепляет стенки сосудов
  • Имеет мочегонное действие
  • Нормализует давление и уровень сахара в крови
  • Выводит шлаки и токсины, очищает печень, сжигает жиры, способствует снижению веса
  • Улучшает память

Не рекомендован кудин беременным и кормящим женщинам (по той же причине, что крепкий чай или кофе), а также детям до 12 лет.

Полезные свойства чая Кудин для похудения

Содержание:
  1. Странный напиток семейства масличных
  2. Полезные свойства горького чая
  3. Применение напитка
  4. Видео о заваривании чая кудин

В мире уже достаточно людей, которые страдают ожирением. И это происходит по разным причинам. У одних играет наследственный фактор, у других — психологическая зависимость от еды. Но каждому хочется стать стройным. Почему бы для похудения не использовать чай Кудин?

Странный напиток семейства масличных

Так называемый «чай» произрастает на юге Китая. Судя по вкусу, его называют «горькая трава». Ку Дин Чай получают из парагвайского Падуба.

Он не относится к категории чая, так как это лист не чайного куста, — а растения семейства масличных. И его внешний вид обычно напоминает веретено, так как листья туго скручены.

Но есть и другая форма — кирпичики (прессованный чай). Этот сорт мягкий по вкусу и не такой горький. Попробуйте Кудин Шуй Сю — один из лучших сортов.

Полезные свойства горького чая

Чудесный напиток обладает многими достоинствами:

  1. Помогает быстро сбросить лишний вес. Но, знайте, что копья Кудина обладают небольшим мочегонным эффектом, и поэтому в целях похудения его рекомендуют употреблять преимущественно в первой половине дня.
  2. К тому же Кудин прекрасно бодрит и тонизирует ваш организм.
  3. Невероятно, но в чае всего 2 ккал, и он настолько насыщает, что после — совсем не хочется есть! Потому как в этом напитке содержится много кофеина, который и снижает ваш аппетит. Калорий становиться меньше и килограммы уходят. Кофеин содержится и в зелёном чае, а также в чёрном кофе, но в больших количествах.
  4. И, кроме того, листья Падуба богаты всевозможными витаминами и микроэлементами. Жизненно необходимые витамины С, E, цинк и железо, — входят в состав напитка.
  5. Вдобавок, копья чая нормализуют все обменные процессы в организме человека, помогают быстрому перевариванию пищи, усиливают активность ферментов печени, что способствует более быстрому расщеплению жиров и углеводов.
  6. Помимо всего прочего, горькая трава имеет много положительных отзывов от людей, которые наконец-то смогли похудеть. Ведь Ку Дин нормализует липидный и углеводный обмен.
  7. К слову сказать: эта трава обладает и лечебными свойствами: давление и сахар в приводит в норму; помогает при простудных и респираторных заболеваниях. Ку Дин (правильное название) обладает ярко выраженным очищающим действием.
Применение напитка

Когда вы начнете пить чай Кудин для похудения, то вам нужно будет научиться чувствовать свой организм. Не надо есть, когда вы не голодны. Старайтесь меньше употреблять солёной пищи, — она задерживает лишнюю жидкость, тогда появляются отёки и лишние килограммы.

Настой запрещено принимать натощак, следует скушать что-нибудь из белковой пищи, например творог.

Принимая напиток, пейте больше чистой воды.

Заваривать листья следует при температуре воды не более 80 градусов. Если вода будет горячая, то и настой получится очень горьким, с неприятным послевкусием полыни.

Не пейте такой напиток вместе с сахаром, конфетами, мёдом или лимоном.

Людям с повышенной массой тела Кудин действительно помогает:

  • после длительного употребления Кудина у человека стабилизируются все основные процессы жизнедеятельности, улучшаются работоспособность и физическая активность.
  • Многие также считают, что Кудин помогает в восстановлении сердечной деятельности. Однако мы знаем, что при заболеваниях сердца запрещены бодрящие травы, — поэтому обязательно проконсультируйтесь у специалиста.
Для успешного похудения, вам необходимо каждодневно выпивать по две — три кружки в день бодрящего чая, а также перейти на низкокалорийное правильное питание.

Не наедайтесь на ночь и слушайте свой организм, иначе даже чай Ку Дин не сможет справиться с вашей проблемой.

Требуется включить JavaScript или обновить плеер!


Просмотров: 12772

Руководство по преимуществам чая Kuding (обновлено на 2019 год)

Руководство по пользе и побочным эффектам чая Kuding

Кудин — это растение, произрастающее в Китае. Согласно историческим документам, это растение применялось как лечебное растение более 2000 лет. Во времена династии Сун его преподносили правительственным чиновникам как дань уважения. Позже производство чая Кудинг (или Кудинг ча) увеличилось, и он стал популярной народной медициной.Чай также часто называют иглой кудинг, так как плоские листья часто скручиваются в игольчатые формы.

Чай Кудин и китайская медицина

Учитывая богатую историю этого растения, мы изучили пользу кудинга для здоровья. Практикующие врачи могут применять это растение при соблюдении следующих условий:

  • Перегрев
  • Головная боль
  • Красные глаза
  • Зубная боль
  • Тиннитус (звон в ушах)
  • Диарея
  • Головокружение
  • Угри

Кудинг Ча и народная медицина

Однако, когда врачи прописывают кудинг, он часто бывает в более концентрированной форме, например, в порошке.Если используются настоящие травы, обычно пациенту рекомендуют варить их в горячей воде в течение нескольких часов. В результате получается высококонцентрированный лечебный напиток, который обычно имеет очень горький вкус.

Хотите попробовать чай Кудинг? Затем купите чай Kuding в Интернете. На этой странице также есть видео, демонстрирующее, как его можно приготовить в заварочном устройстве для чая.

В немедицинском мире кудинг часто употребляют в качестве чая в Китае. Таким образом, эффект намного слабее, и поэтому он считается безопасным для длительного употребления без консультации с врачом.Кроме того, послевкусие более приятное и часто описывается как слегка сладкое и освежающее. Ниже также представлены некоторые другие китайские травяные чаи, которые доступны в нашем интернет-магазине:

Исследование преимуществ чая Kuding

Кожа и старение

В недавнем исследовании, опубликованном в 2019 году (Molecules), ученые пришли к выводу, что полифенолы в Кудинге могут защищать клетки кожи, коллаген и эластин, тем самым предотвращая повреждение кожи у мышей.

Похудание

В исследовании, опубликованном в 2017 году (Nature International Journal of Science), исследователи обнаружили, что кудинг подавляет прибавку в весе у мышей по сравнению с мышами, которых не лечили.Это говорит о том, что кудинг может входить в состав лекарств от ожирения. Авторы считают, что этот эффект является результатом не изменения аппетита, а увеличения расхода энергии, что должно стать предметом дальнейших исследований.

Исследование, проведенное в 2018 году в Эльзевире, также утверждает, что экстракт этанола в Кудинге может уменьшить ожирение и высокий уровень холестерина.

Чай и печень Kuding

В 2017 году исследование, опубликованное в журнале Food & Function Journal, показало, что полисахариды чая Кудинг могут быть полезны для печени.В этом исследовании мыши с высоким содержанием фруктозы вызывали повреждение печени. Когда мышей также кормили кудингом, это показало, что он может облегчить повреждение печени и дисфункцию эндотелия сосудов.

Чай Кудин и язва

В исследовании 2018 года, опубликованном в журнале Food & Function Journal, у мышей было вызвано повреждение желудка. После лечения мышей полифенолами чая кудинг исследование показало, что кудинг оказывает профилактическое действие при травмах желудка.

Диабет, холестерин и артериальное давление

Чай Кудинг содержит полезные компоненты, включая аминокислоты, полифенолы, флавоноиды, цинк и несколько витаминов.Как народная медицина кудинг ча известна по следующей поговорке «降 三 高» (цзян сан гао), что буквально означает «снизь до трех». Это относится к тому факту, что эта трава может помочь снизить высокий уровень сахара в крови (диабет), высокое кровяное давление и высокий уровень холестерина.

Угри и неприятный запах изо рта

Кроме того, антибактериальные свойства кудинга также делают его популярным и эффективным средством против прыщей и неприятного запаха изо рта.

Плодородие

Эта трава иногда может также помочь улучшить фертильность, но это будет зависеть от индивидуальных условий.Здесь мы можем сделать общие заявления. По этому поводу вам следует проконсультироваться с местным врачом китайской медицины.

Сколько и когда пить чай Кудинг?

Правильное количество Кудинга, которое подойдет вам, действительно дайверы, на человека. Обычно люди начинают с замачивания 2-3 игл Кудинг в горячей воде каждое утро и день. Листья можно снова заварить и употреблять, пока не перестанет аромат. Если у вас нет подходящих инструментов, например кружки для заварки, чай может стать горьким.Просто добавьте еще воды, чтобы уменьшить горечь.

Как только некоторые симптомы уменьшатся, можно уменьшить потребление, приготовив кудинг-ча только один раз в день (утром или днем) в профилактических целях.

Побочные эффекты чая Kuding

Этот травяной напиток является эффективным китайским лекарством и в чистом виде считается безопасным, но следует учитывать несколько побочных эффектов чая кудинг:

Беременность

Поскольку кудинг — охлаждающая трава, его следует избегать во время беременности и в период кормления грудью.

Кофеин

Этой травы следует избегать, если вы очень чувствительны к кофеину (хотя она содержит кофеин в минимальных количествах, что даже меньше, чем в обычном чае).

Другое

  • следует избегать людям, страдающим пониженным давлением.
  • следует избегать за 1 месяц до и после операции.
  • Сказанное выше в основном относится к чистой ку-динг-ча. На рынке есть некоторые продукты кудинга, смешанные с другими ингредиентами.Для этого вам нужно внимательно прочитать упаковку.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 за счет бета-антагонизма X-рецепторов печени (LXR)

Введение

Ожирение является мировой проблемой, и его распространенность быстро растет [1]. Ожирение вызвано накоплением избыточных калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4].Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат, одобренный Управлением по контролю за продуктами и лекарствами (Орлистат) для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина.Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при кормлении диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей с резистентностью к инсулину путем регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9].Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей. С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае более 2000 лет в качестве напитка. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью высокоэффективной жидкостной хроматографии с обращенной фазой (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение проводили на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Клеточная культура

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем среду для дифференцировки (DM), содержащую 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Миссури) и 0,8 мМ изобутилметилксантина (IBMX, Sigma, Сент-Луис, Миссури) добавляли к культуре. Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Gene Прямой праймер Обратный праймер
β-Actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17].Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда экспрессионные плазмиды котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина.Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом разделили на разные группы и затем поместили на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и LDL-холестерина (LDL-c) определяли с помощью автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) со 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на срез 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела).Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (фигура S1D) идентичен лупеолу (фигура S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля транспортного средства. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): EK использовали только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты ОТ-ПЦР в реальном времени уровней экспрессии генов в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * Р <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванное диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Затем мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.4, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK.Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеидов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП и ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты ОТ-ПЦР в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля транспортного средства. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют не менее трех независимых экспериментов, а данные представлены как средние значения ± стандартная ошибка среднего.* Р <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27].Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также ингибировались в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке у пациентов с дислипидемией [29], [30] и улучшает кровяное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи.Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что снижение уровня липидов и массы тела не может быть связано со снижением всасывания липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется в экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно ингибируется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные свидетельствуют о том, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1].Ожирение вызвано накоплением избыточных калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат, одобренный Управлением по контролю за продуктами и лекарствами (Орлистат) для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при кормлении диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей с резистентностью к инсулину путем регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае более 2000 лет в качестве напитка. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью высокоэффективной жидкостной хроматографии с обращенной фазой (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение проводили на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Клеточная культура

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем среду для дифференцировки (DM), содержащую 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Миссури) и 0,8 мМ изобутилметилксантина (IBMX, Sigma, Сент-Луис, Миссури) добавляли к культуре. Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Gene Прямой праймер Обратный праймер
β-Actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17].Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда экспрессионные плазмиды котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина.Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом разделили на разные группы и затем поместили на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и LDL-холестерина (LDL-c) определяли с помощью автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) со 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на срез 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела).Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (фигура S1D) идентичен лупеолу (фигура S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля транспортного средства. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): EK использовали только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты ОТ-ПЦР в реальном времени уровней экспрессии генов в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * Р <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванное диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Затем мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.4, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK.Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеидов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП и ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты ОТ-ПЦР в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля транспортного средства. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют не менее трех независимых экспериментов, а данные представлены как средние значения ± стандартная ошибка среднего.* Р <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27].Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также ингибировались в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке у пациентов с дислипидемией [29], [30] и улучшает кровяное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи.Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что снижение уровня липидов и массы тела не может быть связано со снижением всасывания липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется в экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно ингибируется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные свидетельствуют о том, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1].Ожирение вызвано накоплением избыточных калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат, одобренный Управлением по контролю за продуктами и лекарствами (Орлистат) для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при кормлении диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей с резистентностью к инсулину путем регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае более 2000 лет в качестве напитка. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью высокоэффективной жидкостной хроматографии с обращенной фазой (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение проводили на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Клеточная культура

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем среду для дифференцировки (DM), содержащую 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Миссури) и 0,8 мМ изобутилметилксантина (IBMX, Sigma, Сент-Луис, Миссури) добавляли к культуре. Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Gene Прямой праймер Обратный праймер
β-Actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17].Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда экспрессионные плазмиды котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина.Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом разделили на разные группы и затем поместили на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и LDL-холестерина (LDL-c) определяли с помощью автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) со 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на срез 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела).Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (фигура S1D) идентичен лупеолу (фигура S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля транспортного средства. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): EK использовали только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты ОТ-ПЦР в реальном времени уровней экспрессии генов в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * Р <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванное диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Затем мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.4, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK.Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеидов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП и ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты ОТ-ПЦР в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля транспортного средства. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют не менее трех независимых экспериментов, а данные представлены как средние значения ± стандартная ошибка среднего.* Р <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27].Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также ингибировались в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке у пациентов с дислипидемией [29], [30] и улучшает кровяное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи.Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что снижение уровня липидов и массы тела не может быть связано со снижением всасывания липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется в экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно ингибируется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные свидетельствуют о том, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1].Ожирение вызвано накоплением избыточных калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат, одобренный Управлением по контролю за продуктами и лекарствами (Орлистат) для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при кормлении диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей с резистентностью к инсулину путем регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае более 2000 лет в качестве напитка. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью высокоэффективной жидкостной хроматографии с обращенной фазой (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение проводили на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Клеточная культура

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем среду для дифференцировки (DM), содержащую 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Миссури) и 0,8 мМ изобутилметилксантина (IBMX, Sigma, Сент-Луис, Миссури) добавляли к культуре. Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Gene Прямой праймер Обратный праймер
β-Actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17].Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда экспрессионные плазмиды котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина.Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом разделили на разные группы и затем поместили на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и LDL-холестерина (LDL-c) определяли с помощью автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) со 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на срез 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела).Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (фигура S1D) идентичен лупеолу (фигура S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля транспортного средства. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): EK использовали только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты ОТ-ПЦР в реальном времени уровней экспрессии генов в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * Р <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванное диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Затем мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.4, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK.Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеидов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП и ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты ОТ-ПЦР в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля транспортного средства. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют не менее трех независимых экспериментов, а данные представлены как средние значения ± стандартная ошибка среднего.* Р <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27].Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также ингибировались в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке у пациентов с дислипидемией [29], [30] и улучшает кровяное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи.Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что снижение уровня липидов и массы тела не может быть связано со снижением всасывания липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется в экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно ингибируется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные свидетельствуют о том, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Экстракт чая Кудинг предотвращает метаболические нарушения, вызванные диетой с высоким содержанием жиров, у мышей C57BL / 6 через β-антагонизм X-рецепторов печени (LXR)

Введение

Ожирение — проблема во всем мире, и ее распространенность быстро растет [1].Ожирение вызвано накоплением избыточных калорий в виде триглицеридов в жировой ткани и аномально в других тканях [2], что связано с инсулинорезистентностью, диабетом 2 типа, гипертонией, гиперлипидемией, сердечно-сосудистыми заболеваниями, инсультом и неалкогольным стеатогепатитом [3] , [4]. Предотвращение и лечение ожирения принесут большую пользу пациентам с этим заболеванием. В настоящее время существует только один препарат, одобренный Управлением по контролю за продуктами и лекарствами (Орлистат) для длительного использования при лечении ожирения. Поэтому срочно требуются новые терапевтические подходы к лечению ожирения [3].

Рецепторы Х печени (LXR) являются членами семейства ядерных рецепторов факторов транскрипции. Были идентифицированы две изоформы LXR, LXRα и LXRβ, и они являются важными регуляторами гомеостаза липидов и холестерина. Мыши с нокаутом LXRα здоровы, если их кормят диетой с низким содержанием жиров. Однако у мышей с нокаутом LXRα вырабатывается высокий уровень холестерина в печени и увеличивается жировая прослойка печени при кормлении диетой с высоким содержанием жиров [5]. Мыши с нокаутом LXRβ не подвержены влиянию диеты с высоким содержанием жиров, что позволяет предположить, что LXRα и LXRβ играют разные роли [6].

LXR являются потенциальными мишенями для лечения ожирения, дислипидемии и атеросклероза. Предыдущая работа показала, что синтетический агонист LXR GW3965 снижает уровень холестерина как в сыворотке, так и в печени, подавляет развитие атеросклероза на моделях мышей [7], [8] и улучшает толерантность к глюкозе у мышей с ожирением, вызванным диетой, и у мышей с резистентностью к инсулину путем регулирующие гены, участвующие в метаболизме глюкозы в печени и жировой ткани [9]. Однако GW3965 увеличивает уровень триглицеридов в плазме и печени мышей.С другой стороны, антагонисты LXR, такие как 5α, 6α-эпоксихолестерин-3-сульфат, блокируют образование бляшек атеросклероза, подавляя функцию LXR [10]. Разработка новых сильнодействующих и эффективных агонистов и антагонистов LXR без побочных эффектов может быть полезной для клинического использования.

Зеленый чай и чай кудинг — два самых популярных напитка в Китае. Зеленый чай хорошо изучен на предмет его различных преимуществ для здоровья, но данных о биологической активности горького чая мало.Чай Кудин использовался в Китае более 2000 лет в качестве напитка. В традиционной китайской медицине чай кудинг также используется в формулах для лечения ожирения, гипертонии, сердечно-сосудистых заболеваний, гиперлипидемии и различных других заболеваний. Недавно несколько клинических исследований были сосредоточены на его влиянии на снижение липидов, снижение массы тела и снижение уровня глюкозы в крови у пациентов с метаболическими синдромами. Исследования на животных показали, что фенольные компоненты и фенилэтаноидные гликозиды чая кудинг обладают значительной антиоксидантной активностью in vitro [11], [12].Кроме того, чай кудинг также значительно снижает окклюзию и реперфузию средней мозговой артерии (MCAO / реперфузия), вызывает инфаркт и неврологический дефицит и потерю нервных клеток, а также ингибирует фосфорилирование митоген-активированной протеинкиназы и циклооксигеназы-2. Он также увеличивает уровни антиапоптотического белка в головном мозге крыс с MCAO / реперфузией [13]. Общие сапонины из чая ilex kuding улучшают аномальные гемореологические параметры у мышей ApoE — / — , вызванные диетой с высоким содержанием жиров [14].Тритерпеноидные сапонины из листьев чая ilex kuding ингибируют индуцированное ЛПНП образование пенистых клеток и снижают внутриклеточное содержание общего холестерина и триглицеридов [15]. Однако достоверных экспериментальных данных, подтверждающих влияние чая кудинг на ожирение и гиперлипидемию, нет. Здесь мы показываем, что экстракты чая кудинг предотвращают развитие ожирения, гиперлипидемии и толерантности к глюкозе у мышей C57BL / 6, получавших диету с высоким содержанием жиров, и ингибируют трансактивность LXRβ.

Материалы и методы

Анализ отпечатков пальцев с помощью высокоэффективной жидкостной хроматографии с обращенной фазой (RP-HPLC)

Для анализа профилей отпечатков пальцев EK (5 мг) растворяли в метаноле (1 мл).Отфильтрованные экстракты анализировали с использованием системы жидкостного хроматографа Agilent 1200 с УФ-детектором при λ max 270 нм. Хроматографическое разделение проводили на обращенно-фазовой колонке Discovery C-18 (250 × 4,6 мм, 5 мкм) с вводимым объемом 10 мкл метанола (в качестве растворителя A) и воды (в качестве растворителя B). Градиент был установлен следующим образом: 0 ~ 10 мин, 5% B; 20 мин, 30% B; 25 мин, 50% B; 40 мин, 90% B; 45 мин, 95% B (скорость потока 1 мл / мин).

Урсоловая кислота и лупеол (чистота> 98%) были приобретены в Шанхайском научно-исследовательском центре стандартизации китайских лекарственных средств (Шанхай, Китай).Соединения контролировали при 210 нм с использованием колонки Discovery C18 с метанолом или ацетонитрилом (в качестве растворителя A) и водой, содержащей 0,1% фосфорной кислоты (в качестве растворителя B) в подвижной фазе, при скорости потока 1,0 мл / мин при 30 ° C. на 60 мин. Чтобы обнаружить урсоловую кислоту, градиентное элюирование ВЭЖХ составляло 48% A (ацетонитрил) и 52% B (фосфорная кислота, pH 2,5) в течение 0 минут, 75% A и 25% B через 40 минут, 85% A и 15% B. в 60 мин. Постоянную подвижную фазу метанол: вода (98 ± 2, об. / Об.) Использовали для обнаружения лупеола.

Клеточная культура

Клетки 3T3-L1 выращивали и поддерживали в среде DMEM, содержащей 10% фетальной бычьей сыворотки (Hyclone, Logan, UT). Для дифференцировки адипоцитов клетки выращивали в 12-луночных планшетах до полного слияния в течение 2 дней, а затем среду для дифференцировки (DM), содержащую 10 мкг / мл инсулина (Sigma, Сент-Луис, Миссури), 0,5 мкМ дексаметазона (Sigma, Сент-Луис). , Миссури) и 0,8 мМ изобутилметилксантина (IBMX, Sigma, Сент-Луис, Миссури) добавляли к культуре. Через 4 дня среду заменяли на DMEM с 10% фетальной телячьей сывороткой для дифференциации при 37 ° C в 10% CO 2 .ЭК растворяли в ДМСО и добавляли к среде в указанных концентрациях. ДМСО добавляли к клеткам в качестве необработанного контроля.

Окрашивание масляным красным О

Клетки дважды промывали PBS, фиксировали 10% формалином при комнатной температуре в течение 10 минут, а затем окрашивали масляным красным О (Sigma, Сент-Луис, Миссури) при 60 ° C в течение 10 минут. минут. Затем были сделаны снимки с помощью микроскопа Olympus (Токио, Япония).

Количественная ПЦР в реальном времени

Тотальную РНК экстрагировали с использованием спин-колонки (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя, и РНК обрабатывали ДНКазой I для удаления загрязнения геномной ДНК.Первая цепь кДНК была синтезирована с использованием набора для синтеза кДНК (Fermentas, Madison, WI), а уровни экспрессии генов были проанализированы с помощью количественной ОТ-ПЦР в реальном времени с использованием системы ABI Stepone Plus Real Time PCR (Applied Biosystems, Карлсбад, Калифорния) . Праймеры, использованные в экспериментах, показаны на. Уровни мРНК всех генов нормализовали с использованием β-актина в качестве внутреннего контроля.

Таблица 1

Последовательности праймеров, используемых в ПЦР в реальном времени.

Gene Прямой праймер Обратный праймер
β-Actin TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA
LXRα GAGTGTCGACTTCGCAAATGC CCTCTTCTTGCCGCTTCAGT
LXRβ CAGGCTTGCAGGTGGAATTC ATGGCGATAAGCAAGGCATACT
ABCA1 GGCAATGAGTGTGCCAGAGTTA TAGTCACATGTGGCACCGTTTT
ABCG1 TCCCCACCTGTAAGTAATTGCA TCGGACCCTTATCATTCTCTACAGA
ApoE GAACCGCTTCTGGGATTACCT TCAGTGCCGTCAGTTCTTGTG
Cyp7a1 GTGGTAGTGAGCTGTTGCATATGG CACAGCCCAGGTATGGAATCA
SREBP1 GGCTATTCCGTGAACATCTCCTA ATCCAAGGGCATCTGAGAACTC
FAS CTGAGATCCCAGCACTTCTTGA GCCTCCGAAGCCAAATGAG
LPL ATCGGAGAACTGCTCATGATGA CGGATCCTCTCGATGACGAA
C / EBPβ GGGGTTGTTGATGTTTTTGG CGAAACGGAAAAGGTTCTCA
PPARα AGGCTGTAAGGGCTTCTTTCG GGCATTTGTTCCGGTTCTTC
PPARγ CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC
PPARβ / δ AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT
C / EBPα CGCAAGAGCCGAGATAAAGC CACGGCTCAGCTGTTCCA
AP2 CATGGCCAAGCCCAACAT CGCCCAGTTTGAAGGAAATC
ACC GAATCTCCTGGTGACAATGCTTATT GGTCTTGCTGAGTTGGGTTAGCT
ACO CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG
УЦП-2 GGGCACTGCAAGCATGTGTA TCAGATTCCTGGGCAAGTCACT

Трансфекция культивируемых клеток и репортерные анализы

Репортерный анализ проводили, как описано ранее [16], [17].Вкратце, клетки 293Т выращивали в 24-луночном планшете для трансфекции. Экспрессионная плазмида pCMXGal-рецептор, активируемый пролифератором пероксисом мыши (PPAR) α, γ, β / δ, LXRα и LXRβ-LBD, и репортерный вектор Gal4 Mh200 × 4-TK-Luc были подарками доктора Р. Эванса [18] и д-р Саез [19], [20]. Когда экспрессионные плазмиды котрансфицировали репортерной конструкцией, 1 мкг соответствующей плазмиды объединяли с 1 мкг репортерной плазмиды и 0,1 мкг репортера pREP7 (реллина люцифераза) для нормализации эффективности трансфекции.Все трансфекции включали 2,1 мкг общих плазмид и 5 мкл FuGENE HD (Roche, Германия) на мл DMEM. Раствор для трансфекции добавляли к клеткам 293T на 24 часа, а затем удаляли и добавляли 10 мкМ PPARγ, PPARα, PPARβ / δ и агониста LXR розиглитазона, WY14643, GW0742 и GW3965 или EK перед сбором клеток для определения активности люциферазы. 24 часа спустя. Анализы репортера люциферазы проводили с использованием системы анализа репортера двойной люциферазы (Promega, Сан-Луис-Обиспо, Калифорния), и эффективность трансфекции нормализовали в соответствии с активностью люциферазы реллина.Все эксперименты по трансфекции независимо выполняли трижды.

Животные и химический анализ сыворотки

Протоколы на животных, использованные в этом исследовании, были одобрены Шанхайским университетом традиционной китайской медицины для исследований на животных (утвержденный Nember: 11002). Самки мышей C57BL / 6 были приобретены в лаборатории SLAC (Шанхай, Китай). Всех мышей содержали при контролируемой температуре (22–23 ° C) и при 12-часовом световом цикле и 12-часовом темноте. Для профилактического эксперимента мышей C57BL / 6 аналогичного возраста и веса тела случайным образом разделили на разные группы и затем поместили на диету с высоким содержанием жиров (60% калорий, полученных из жира, Research Diets, Нью-Брансуик, Нью-Джерси; D12492) или на диете с высоким содержанием жиров, смешанной с 0.05% EK или на низкокалорийной диете в качестве эквивалентной контрольной диеты (10% калорий, полученных из жиров, Research Diets; D12450B). Исследование диеты было начато в возрасте 6 недель и продолжалось в течение 11 недель. Для терапевтического эксперимента мышей помещали на диету с высоким содержанием жиров на 3 месяца, а затем мышей с ожирением группировали случайным образом. EK вводили через желудочный зонд в течение 2 недель в дозе 50 мг / день / кг (HF + EK), в то время как контрольным мышам давали воду через желудочный зонд (HF). Нормальных контрольных мышей содержали на обычной диете в течение всего эксперимента (Chow).Двадцать четыре часа приема пищи измеряли путем регистрации разницы в весе между кормом, помещенным в клетку, и оставшимся по истечении 24 часов как в обработанных группах, так и в контроле. Экспериментальные диеты не привели к каким-либо изменениям в суточном потреблении пищи по сравнению с контролем. Уровни триглицеридов (TG) в сыворотке крови, общего холестерина (TC), холестерина HDL (HDL-c) и LDL-холестерина (LDL-c) определяли с помощью автоматического анализатора Hitachi 7020 (Hitachi, Токио, Япония) со 100 мкл сердечной крови. сыворотка.

Анализ содержания липидов в печени и кале

Образцы печени взвешивали и гомогенизировали в буфере для лизиса тканей (20 мМ Трис · HCl pH 7,5, 150 мМ NaCl, 1% тритон) и экстрагировали равным объемом хлороформа. Слои хлороформа сушили и растворяли в изопропиловом спирте для измерения уровней липидов, как описано выше. Фекальные липиды также экстрагировали и измеряли, как описано выше.

Окрашивание гематоксилином и эозином (H&E)

Для окрашивания H&E ткань фиксировали в 10% формальдегиде, заливали в состав ОКТ и разрезали на срез 10 мкм в соответствии со стандартным протоколом.Срезы окрашивали гематоксилином и эозином и исследовали под световым микроскопом.

Растровая электронная микроскопия

Растровая электронная микроскопия использовалась для исследования структуры жировой ткани в соответствии с ранее описанными протоколами [21]. Изображения были получены с помощью растрового электронного микроскопа Philip XL-30.

Тест на внутрибрюшинную толерантность к глюкозе

После 2 недель лечения мышей C57BL / 6 не кормили в течение ночи в течение 12 часов. Образцы крови собирали из хвостовой вены для определения исходных значений глюкозы (0 минут) перед инъекцией глюкозы (1 г / кг веса тела).Дополнительные образцы крови собирали через равные промежутки времени (15, 30, 60 и 90 минут) для измерения глюкозы.

Статистический анализ

Анализ данных проводился с использованием статистической программы SPSS12.0 для Windows. Все данные были представлены как средние значения ± стандартная ошибка. Статистический анализ был выполнен с помощью одностороннего дисперсионного анализа (ANOVA). Различия считались достоверными при Р <0,05.

Результаты

Профилирование EK по отпечатку пальца

Для анализа компонентов этанольного экстракта чая кудинг мы проанализировали отпечаток EK с помощью ВЭЖХ.На рисунке S1A показано, что EK содержит несколько пиков, согласующихся с предыдущими выводами. Далее мы сравнили элементы ЭК с известными соединениями урсоловую кислоту и лупеол. Рисунок S1B показывает, что существует пик поглощения на 41,147 мин времени удерживания, который совпадает с пиком урсоловой кислоты (Рисунок S1C). Точно так же пик ЭК при времени удерживания 17,379 мин (фигура S1D) идентичен лупеолу (фигура S1E). Эти результаты согласуются с предыдущим отчетом [22].

ЭК ингибирует дифференцировку адипоцитов 3T3-L1

Поскольку чай кудинг использовался для профилактики и лечения ожирения и гиперлипидемии, мы наблюдали влияние ЭК на дифференцировку адипоцитов 3T3-L1.Мы использовали инсулин, дексаметазон и изобутилметилксантин (среда для дифференцировки, DM), чтобы вызвать дифференцировку преадипоцитов 3T3-L1. Во время индукции СД в среду добавляли ЭК с 0 по 6 день дифференцировки. Результаты показали, что этанольный экстракт чая кудинг значительно ингибировал дифференцировку адипоцитов 3T3-L1, тогда как водный экстракт чая кудинг не влиял на дифференцировку адипоцитов 3T3-L1 (), что указывает на потенциальный агент для лечения ожирения и дислипидемии. могут быть жирорастворимые компоненты.В результате мы использовали этанольный экстракт в следующих экспериментах.

Этаноловый экстракт чая кудинг ингибирует дифференцировку адипоцитов 3T3-L1.

Водный экстракт и этанольный экстракт добавляли в среду в концентрации 20 мкг / мл. ДМСО использовали в качестве контроля транспортного средства. Клетки окрашивали масляным красным О на 6 день дифференцировки. GM: питательная среда; DM: среда дифференциации.

EK ингибирует более позднюю стадию дифференцировки адипоцитов 3T3-L1

Дифференцировка адипоцитов 3T3-L1 включает два этапа: 4-дневная индукция и 5-7-дневная дифференцировка, оба из которых контролируются различными молекулярными событиями [23], [24], активация фактора транскрипции и экспрессия липогенного гена соответственно.Чтобы проверить, какой процесс дифференцировки адипоцитов ингибирует ЭК, ​​ЭК добавляли в культуральную среду на разных этапах. Когда EK добавлялся во время индукции и удалялся во время дифференцировки, дифференцировка явно не изменялась (). Интересно, что когда EK добавляли после завершения индукции, дифференцировка значительно подавлялась (), указывая на то, что EK может нарушать более поздние стадии процессов дифференцировки адипоцитов 3T3-L1.

EK ингибирует дифференцировку адипоцитов 3T3-L1, индуцированную СД.

(A): EK использовали в начале индукции DM клеток 3T3-L1 и удаляли во время дифференцировки. (B): EK использовали только во время дифференцировки клеток 3T3-L1. Клетки окрашивали масляным красным О на 6 день дифференцировки. (C): результаты ОТ-ПЦР в реальном времени уровней экспрессии генов в адипоцитах 3T3-L1. Клетку дифференцировали в течение 6 дней, а затем клетку обрабатывали EK в концентрации 20 мкг / мл в течение 24 часов. DM: среда дифференциации. β-актин использовали в качестве внутреннего контроля.Данные представлены как средние значения ± стандартная ошибка для 4 обработок. * Р <0,05.

Чтобы подтвердить это, была проведена количественная ПЦР для проверки изменений экспрессии генов родственных генов в адипоцитах 3T3-L1, обработанных EK. Результаты показали, что ЭК значительно ингибирует экспрессию маркера адипоцитов PPARγ и aP2. Экспрессия синтазы жирных кислот (FAS) также снижалась после лечения EK. Однако лечение ЭК не изменило экспрессию генов АСС, CD36 и UCP2 ().

EK блокирует ожирение и гиперлипидемию, вызванное диетой с высоким содержанием жиров у мышей C57BL / 6.

Затем мы исследовали влияние EK на увеличение массы тела, вызванное диетой с высоким содержанием жиров, у мышей C57BL / 6.После 5 недель лечения масса тела мышей, получавших диету с высоким содержанием жиров, значительно увеличилась по сравнению с массой тела мышей, получавших стандартную диету (кормление). При добавлении EK набор массы тела был намного меньше, чем у контрольных мышей HF (). Поскольку подавление увеличения массы тела может быть вызвано меньшим количеством потребляемой пищи, мы исследовали количество потребляемой пищи у мышей. EK не подавлял потребление пищи по сравнению с таковым у контрольных мышей HF (), указывая на то, что снижение массы тела у мышей, получавших EK, не было результатом более низкого потребления калорий.Затем мы проверили содержание ТГ в кале, чтобы оценить, ингибирует ли ЭК абсорбцию липидов в кишечнике. Результаты показали, что лечение ЭК не повлияло на содержание ТГ в кале (), что позволяет предположить, что роль ЭК в блокировании увеличения массы тела не является результатом ингибирования всасывания липидов. Затем мы исследовали массу адипоцитов с помощью сканирующего электронного микроскопа. Размер как белых адипоцитов, так и коричневых адипоцитов был значительно уменьшен по сравнению с контрольными адипоцитами при диете HF (), что указывает на то, что EK защищает от индуцированного HF увеличения жировой массы.

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением, вызванным диетой с высоким содержанием жиров.

(A): прибавка в массе тела. (B): Количество потребляемой пищи. (C): Содержание ТГ в кале. (D): изображения белых и коричневых адипоцитов под растровым электронным микроскопом. (E): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеинов высокой плотности (HDL-c) в сыворотке крови. (F): Влияние EK на толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT).Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

Ожирение тесно связано с гиперлипидемией и инсулинорезистентностью, поэтому мы проверили уровень липидов сыворотки и уровень глюкозы в крови натощак на мышах. Анализ липидов сыворотки показал, что лечение ЭК привело к снижению уровней LDL-c в условиях диеты HF, но уровни TG, TC и HDL-c существенно не изменились (). Уровни глюкозы натощак были ниже, чем у контрольных мышей HF (0 мин). Затем мы исследовали, может ли лечение ЭК повлиять на толерантность к глюкозе, используя тест толерантности к глюкозе.Уровни глюкозы в крови измеряли с интервалами 15, 30, 60 и 90 минут после внутрибрюшинных инъекций глюкозы 1 г / кг. Как показано на фиг.4, уровни глюкозы у мышей, получавших HF-диету, были заметно выше, чем у мышей, получавших диету. Лечение EK значительно снижало уровни глюкозы во все моменты времени, предполагая, что EK улучшает толерантность к глюкозе у мышей C57BL / 6, получавших диету с HF.

EK предотвращает накопление липидов в печени мышей C57BL / 6

Чтобы оценить влияние EK на стеатоз печени, вызванный диетой с высоким содержанием жиров, мы исследовали содержание жира и липидный профиль в печени мышей, получавших EK.Окрашивание HE показало, что мыши, получавшие диету с высоким содержанием жиров в течение 5 недель, имели морфологию тканей гепатоцитов, аналогичную мышам, получавшим стандартную диету (). Окрашивание масляным красным О показало, что липиды накапливались в печени мышей HF по сравнению с таковыми у мышей контрольной группы (), и что обработка EK заметно предотвращала накопление липидов в печени (). Для подтверждения этих результатов было проанализировано содержание ТГ и ТС в печени. Уровни TG у мышей, получавших HF-диету, были заметно выше, чем у контрольных мышей, тогда как лечение EK значительно предотвращало накопление TG в печени, вызванное диетой с высоким содержанием жиров ().Общее содержание ОХ в печени достоверно не изменилось во всех группах (). Результаты показывают, что ЭК может предотвращать накопление липидов и блокировать развитие стеатоза печени, вызванного диетой с высоким содержанием жиров у мышей.

EK улучшает накопление липидов в печени мышей C57BL / 6, индуцированных диетой с высоким содержанием жиров.

(A-C): окрашивание H&E (× 200) печени из стандартной диеты (A), диеты HF (B) и мышей HF + EK (C). (D-F): Окрашивание масляным красным О (× 400) срезов печени из стандартной диеты (D), диеты HF (E) и мышей HF + EK (F).Срезы контрастировали гематоксилином. Приведены количественные результаты по содержанию ТГ (G) и TC (H) в печени. Мышей кормили диетой с высоким содержанием жиров в течение 5 недель, и EK измельчали ​​и добавляли в рацион в концентрации 0,05% (вес / вес). Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0,05.

EK улучшает метаболические нарушения у тучных мышей

Затем мы проверили, может ли EK влиять на метаболические нарушения у тучных мышей. После 3 месяцев кормления диетой с высоким содержанием жиров у мышей C57BL / 6 развилась высокая масса тела, уровень липидов сыворотки и уровень глюкозы в крови.Затем мышей разделили на две группы и лечили 50 мг / кг / день ЭК в течение 2 недель. Лечение ЭК не привело к значительному снижению массы тела (), и количество потребляемой пищи также не изменилось (). Однако лечение ЭК привело к уменьшению размера белых адипоцитов у мышей с ожирением по сравнению с таковыми у контрольных мышей ().

EK улучшает метаболические нарушения у мышей C57BL / 6 с ожирением.

(A): Масса тела до и после лечения. (B): Количество потребляемой пищи. (C): изображения белых адипоцитов с использованием сканирующей электронной микроскопии.(D): Уровни общего холестерина (TC), триглицеридов (TG), холестерина липопротеинов низкой плотности (LDL-c) и холестерина липопротеидов высокой плотности (HDL-c) в сыворотке крови. (E): толерантность к глюкозе у мышей, получавших HFD, как определено тестом на толерантность к глюкозе (GTT). Мышам вводили глюкозу в дозе 1 мг / кг для внутрибрюшинного теста на толерантность к глюкозе, и уровни глюкозы проверяли с регулярными интервалами в 15, 30, 60 и 90 минут. Н.Ш .: Никакого значения. Данные представлены как среднее ± стандартная ошибка. N = 7 для всех групп. * Р <0.05.

Анализ липидов сыворотки показал, что уровни TC, TG, LDL-c и HDL-c у мышей с ожирением были значительно увеличены по сравнению с таковыми у мышей, получавших стандартную диету. Лечение ЭК заметно снизило содержание ТГ, но не изменило уровни общего холестерина, ЛПНП и ЛПВП в сыворотке (), что свидетельствует о различных эффектах ЭК на липидный профиль при профилактике и лечении мышей с ожирением.

Кроме того, мы проверили уровни глюкозы в крови натощак и толерантность к глюкозе у мышей, получавших EK. показывает, что уровни глюкозы натощак у мышей, получавших EK, были снижены по сравнению с таковыми у необработанных мышей, а уровни глюкозы также улучшились через 30 и 60 минут после внутрибрюшинных инъекций глюкозы, предполагая, что EK может улучшить толерантность к глюкозе.Взятые вместе, эти результаты показывают, что ЭК может облегчить метаболические нарушения у мышей с ожирением, вызванным диетой.

EK ингибирует липогенную экспрессию гена в печени мыши

Чтобы проверить эффекты EK in vivo, мы исследовали экспрессию гена в печени мышей, получавших EK. Как показано на фиг.1, уровни мРНК факторов транскрипции, таких как PPARγ, CEB / Pα, и липогенных генов, таких как ацил-CoA-оксидаза (ACO), ацетил-кофермент A-карбоксилаза (ACC) и aP2, были снижены в печени, обработанной EK, что позволяет предположить, что на экспрессию липогенных генов влияет лечение ЭК.

EK подавляет экспрессию липогенных генов в печени мышей.

Дифференцировка адипоцитов 3T3-L1, индуцированная СД. Результаты ОТ-ПЦР в реальном времени уровней экспрессии генов PPARγ, PPARα, PPARδ / ß, C / EBPα, C / EBPβ, UCP2, ACO, ACC и aP2 в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF из профилактическое лечение. β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

Чай Kuding содержит лиганд антагониста LXRβ

Факторы транскрипции ядерных рецепторов являются важными регуляторами гомеостаза липидов и глюкозы.Основываясь на подавлении ожирения и гиперлипидемии, мы проверили, действует ли ЭК на PPARγ, α, β / δ и LXRα и LXRβ, которые являются лекарственными мишенями для метаболических синдромов [25], [26]. Мы не наблюдали ингибирующих эффектов ЭК на трансактивность PPARγ, α, β / δ (данные не показаны) или LXRα (). Однако трансактивность LXRβ, индуцированная GW3965, значительно ингибировалась EK дозозависимым образом (), предполагая, что EK может содержать лиганд антагониста LXRβ.

EK Анализ активности транскрипции ядерных рецепторов.

(A, B): транс-активности LXRα и LXRβ. Плазмиды экспрессии pCMXGal-мышиный LXRα и LXRβ-LBD котрансфицировали репортерным вектором Gal4 Mh200 × 4-TK-Luc в клетку 293T в течение 24 часов. Затем клетку обрабатывали 10 мкМ агониста LXR GW3965 и / или 5–20 мкг / мл ЭК в течение еще 24 часов. ДМСО использовали в качестве контроля транспортного средства. Относительные активности люциферазы измеряли путем сравнения с активностями люциферазы реллина. Результаты представляют не менее трех независимых экспериментов, а данные представлены как средние значения ± стандартная ошибка среднего.* Р <0,05. (C) Уровни экспрессии генов-мишеней LXR в печени мышей, обработанных EK, сравнивали с таковыми у контрольных мышей HF, получавших профилактическое лечение, и β-актин использовали в качестве внутреннего контроля. Данные представлены как средние значения ± стандартная ошибка для 5 мышей на группу. * Р <0,05.

LXR регулирует метаболизм липидов и глюкозы посредством активации экспрессии набора генов-мишеней, включая синтазу жирных кислот (FAS), белок-1c, связывающий регуляторный элемент стерола (SREBP-1c), липопротеинлипазу (LPL), ATP- переносчик связывающей кассеты A1 (ABCA1), переносчик АТФ-связывающей кассеты G1 (ABCG1) и сам LXR [27].Затем мы оценили эффект in vivo EK на экспрессию генов, связанных с активностью LXRβ, путем анализа уровней экспрессии мРНК в тканях печени, выделенных от мышей, получавших EK, и контрольных мышей HF. Уровни LXRα / β, ApoE, ABCA1 и SREBP1 также ингибировались в печени мышей, получавших EK (), что указывает на то, что некоторые компоненты чая кудинг могут действовать как антагонисты LXRβ.

Обсуждение

В этом исследовании мы предоставляем доказательства того, что чай кудинг может предотвратить и облегчить метаболические нарушения у мышей, получавших диету с высоким содержанием жиров.Наши результаты ясно показали, что лечение ЭК блокирует увеличение массы тела, гиперлипидемию и инсулинорезистентность у мышей, вызванную диетой с сердечной недостаточностью. Химические и гистологические данные показали, что лечение ЭК привело к значительному снижению накопления липидов в печени мышей DIO, предполагая, что ЭК оказывает защитное действие против развития метаболических нарушений, таких как ожирение, дислипидемия, диабет и стеатоз печени у мышей. Мы также обнаружили, что ЭК может улучшить метаболические нарушения у мышей с ожирением.Кроме того, мы определили, что ЭК избирательно подавляет трансактивность фактора транскрипции ядерного рецептора LXRβ. Таким образом, результаты этого исследования предполагают, что защитный эффект ЭК против метаболических нарушений, вероятно, связан с его ингибирующим действием на LXRβ.

Чай Кудин — популярный напиток в Китае. Как и зеленый чай, чай кудинг используется в медицинских составах для облегчения нарушений обмена веществ, таких как ожирение. В последние годы сообщалось, что чай кудинг обладает различными биологическими эффектами [28].Было показано, что чай кудинг снижает уровни ТГ, ОХ и ЛПНП в сыворотке у пациентов с дислипидемией [29], [30] и улучшает кровяное давление у пациентов с гипертонией I фазы, а также предотвращает прогрессирование атеросклероза [31], [32].

У мышей C57BL / 6 могут развиваться метаболические синдромы при употреблении диеты с высоким содержанием жиров. В текущем исследовании у мышей, получавших диету с высоким содержанием жиров в течение 5 недель, были значительно увеличены масса тела, уровни TC, TG, LDL-c и TG в печени, толерантность к глюкозе. Лечение ЭК привело к значительному снижению прибавки в весе и ОС в сыворотке, а также к улучшению толерантности к глюкозе и накоплению липидов в печени, что позволяет предположить, что ЭК может предотвратить развитие метаболических синдромов.

Увеличение веса является следствием увеличения массы и количества адипоцитов, вызванного избыточными калориями, хранящимися в виде ТГ [33], в то время как потеря веса обычно вызывается уменьшением массы и количества адипоцитов за счет подавления потребления энергии или чрезмерного сжигания избытка. калорий. Конкретные механизмы, с помощью которых ЭК защищает от увеличения веса, еще предстоит определить. Есть несколько вероятных возможностей, основанных на данных, полученных в результате наших исследований. Поскольку сокращение потребления пищи может значительно повлиять на массу тела, уровень глюкозы и липидов в крови, мы рассмотрели возможность того, что эффект ЭК может быть результатом уменьшения потребления пищи.Однако мы не наблюдали разницы в количестве потребляемой пищи между мышами, получавшими HF, и мышами, получавшими EK. Сообщалось, что зеленый чай подавляет всасывание липидов в кишечнике [34] — [36]. Однако наши данные показали, что чай кудинг не оказывает ингибирующего действия на всасывание липидов. Таким образом, вероятно, что снижение уровня липидов и массы тела не может быть связано со снижением всасывания липидов на кишечном уровне. Взятые вместе, наши данные показывают, что защитные механизмы ЭК против увеличения массы тела не зависят от снижения потребления энергии и всасывания липидов в кишечнике.

В нашем терапевтическом эксперименте у мышей с ожирением, получавших EK, наблюдались более низкие уровни ТГ и глюкозы натощак, чем у контрольных мышей с ожирением. Однако у мышей не наблюдается значительной потери массы тела, снижения общего содержания холестерина или холестерина ЛПНП. Это несоответствие может быть вызвано двумя причинами. Во-первых, было доказано, что удаление лишнего жира намного труднее, чем предотвращение набора жира. Во-вторых, в профилактической терапии мы лечили мышей в течение 5 недель, но мышей лечили только в течение двух недель для терапевтического лечения.Таким образом, результаты настоящего исследования не подтверждают влияние чая кудинг на снижение веса в клинических испытаниях, о которых сообщали предыдущие исследователи. Толерантность к глюкозе улучшилась при профилактическом лечении, но была менее эффективной при терапевтическом лечении. Это может быть результатом уменьшения жировой ткани, поскольку отложение ТГ в клетках отвечает за развитие инсулинорезистентности [37] — [39].

По сравнению с водным экстрактом чая кудинг, этанольный экстракт ингибировал дифференцировку адипоцитов адипоцитов 3T3-L1, что позволяет предположить, что жирорастворимые компоненты чая кудинг могут действовать на адипоциты.Химический анализ показал, что этанольный экстракт чая кудинг содержит 11 основных соединений: лупеол, 11-кето-α-амирин пальмитат, α-амирин пальмитат, 12-урсен-3,28-диол, урсоловую кислоту, 3β-гидроксилюп- 20 (29) -ен-30-ал, 3β-гидрокси-20-оксо-30-норлупан, танацетен, β-ситостерин, н-бегеновая кислота и н-гексакозан [22]. Среди них урсоловая кислота изучена на предмет ее воздействия на метаболические нарушения. Например, урсоловая кислота усиливает связывание PPAR-α с PPRE, регулирует экспрессию генов метаболизма липидов и значительно снижает внутриклеточные концентрации триглицеридов и холестерина в гепатоцитах [40], а также снижает массу тела, висцеральное ожирение, уровни глюкозы в крови и плазме. липидов, а также увеличение лептина в плазме у мышей, получавших диету с высоким содержанием жиров [41] — [43].Сообщалось также, что лупеол снижает уровень глюкозы в крови у экспериментальных животных с диабетом [44], [45]. Однако в экстракте, используемом в текущем исследовании, он содержит только 6,48% урсоловой кислоты (около 1/20 использовалось в предыдущих исследованиях), что позволяет предположить, что урсоловая кислота не единственный эффективный компонент. Активные вещества в чае кудинг должны быть исследованы на предмет их роли при метаболических заболеваниях. Или система кишечной проницаемости может быть использована для выяснения механизма воздействия чая кудинг на адипоцит 3T3L1.

Опубликованные данные о механизме действия чая кудинг ограничены, но исследования показывают, что чай кудинг может улучшить метаболические расстройства с помощью нескольких механизмов.Наши данные предполагают, что чай кудинг может предотвращать метаболические нарушения, избирательно воздействуя на ядерные рецепторы факторов транскрипции LXRβ. Семейство LXR представляет собой активируемые лигандом факторы транскрипции, включая LXRα и LXRβ. LXRα экспрессируется главным образом в печени, жировой ткани и макрофагах, тогда как LXRβ экспрессируется повсеместно [5], [6]. Потенциал LXR в качестве мишени для лекарств при гиперлипидемии, AS, диабете, гипертонии и воспалении был ранее показан [46], [47]. Дальнейшее исследование эффектов EK на мышей с нокаутом LXRβ подтвердит сигнальный путь EK.И, вероятно, это позволит идентифицировать ингибирование LXRβ как терапию метаболических заболеваний in vivo.

Предыдущие исследования показали, что агонисты LXR могут снижать уровни ОХ в сыворотке, но повышать уровни ТГ в печени и сыворотке, что исключает агонисты LXR в качестве терапии метаболических заболеваний. Разработка селективных агонистов или антагонистов LXR может избежать нецелевых эффектов [19]. Недавно было подтверждено, что два встречающихся в природе соединения, реин и нарингенин, являются антагонистами LXRα / β и LXRα соответственно, и также было показано, что они обладают свойствами снижения гиперлипидемии [48], [49].Kanaya et al. Сообщили, что белые шампиньоны обладают защитным действием против стеатоза печени за счет ингибирования передачи сигналов LXR [50]. Мы показываем, что ЭК селективно ингибирует трансактивность LXRβ в присутствии агониста LXRβ GW3965, предполагая, что ЭК содержит антагонист LXRβ, который конкурентно связывается с LXRβ. Метаболический эффект ингибирования LXRβ с помощью ЭК также проявляется в экспрессии генов. Экспрессия мРНК LXRβ нацелена на гены, которые контролируют окисление жирных кислот, регулируют синтез жирных кислот и холестерина, такие как ABCA1, ABCG1, LPL и ApoE, и значительно ингибируется в печени и жировой ткани мышей, получавших EK.Идентификация этого специфического лиганда LXRβ может привести к новой терапии метаболических заболеваний.

В заключение мы приводим доказательства того, что ЭК защищает от развития ожирения, гиперлипидемии и инсулинорезистентности у мышей, получавших диету с высоким содержанием жиров. Эти данные свидетельствуют о том, что ЭК можно использовать в качестве потенциальной диетической стратегии для предотвращения метаболических нарушений, таких как ожирение, гиперлипидемия, диабет и атеросклероз. Потенциал использования натуральных пищевых добавок для регулирования массы тела и липидного обмена является привлекательным.Поскольку этот традиционный напиток безопасен и дешев, его следует рассматривать как диетическое средство для лечения метаболических синдромов. Это особенно важно, потому что потеря веса и лечение неалкогольной жировой болезни печени малоэффективны в долгосрочной перспективе. Необходимы дальнейшие исследования, чтобы определить механизмы, с помощью которых этот компонент защищает от ожирения и связанных с ним симптомов.

Смешно горький китайский чай, который останавливает зиму на своем пути

Добро пожаловать в Rocket Fuel, новую серию, рассказывающую о волшебных напитках, от которых просыпается мир.

Погода на свитере наступает, и внезапно у всех нас возникает простуда, или сильная аллергия, или боль в горле, и наши утренние распорядки теперь имеют дополнительную цель: заставить нас чувствовать себя достаточно человечными, чтобы войти в мир бодрствования. Когда у вас голова простужена настолько туманно, что вы почти не видите прямой, сушащий для рта кофе или даже заваривание привычного чая — этого недостаточно. Пришло время для чего-то покрепче.

Введите ядерный вариант: китайский травяной чай kuding cha . Это одно из самых горьких веществ, которое вы можете безопасно проглотить, и его скользкость по горлу ощущается как дистилляция дюжины капель от кашля, достаточно мощных, чтобы стереть даже воспоминания о боли в горле.Назовите это амаро кишками Только не сбивайте его, пока не попробуете хотя бы несколько раз; Чай кудинг , мягко говоря, приобретенный вкус, но как только он начинает расти на вас, его трудно перестать пить.

За его горечью, если вы можете себе представить что-нибудь под ним, скрываются нежные травяные, травянистые качества и, в конце, глубокая, продолжительная медовая сладость, которая укрощает большую часть этого горького привкуса. Это то, что дает вам чай кудинг, и почему он пользуется популярностью у небольшой субкультуры людей, которые пьют его не только в лечебных целях, но и в развлекательных целях.У сладкого чая, за который нужно страдать, есть свои награды.

В стране, где названия чая могут склоняться к поэтике («железная богиня милосердия», «бровь долголетия»), чай kuding впечатляюще прост: буквально «чай с горьким гвоздем», описывающий не только вкус, но и иглу. -подобная форма его скрученных засохших листьев. Как и в случае со многими другими лекарственными травами, пьющие в провинциях Гуанси и Аньхуэй (и в других местах) приписывают этому растению падубу широкий спектр лечебных свойств, родственник Нового Света пьет yerba mate , guayusa и Япон . Кудинг чай, который содержит немного кофеина, якобы может улучшить кровообращение, помочь вам похудеть, регулировать температуру тела и, конечно же, вылечить простуду. Я скептически отношусь ко всем этим утверждениям, но нет никаких сомнений в том, что богатая текстура чая и глубокая горечь обладают способностью успокаивать горло, как ничто другое. В западном каноне горечь недооценивают, но это впечатляющая кнопка физиологической перезагрузки. Когда вы это глотаете, никакой душный холод не побеспокоит вас.

Если вы хотите присоединиться к подполью kuding , ищите его в магазинах китайских травников или в Интернете. Одного пера хватит на порцию; воткните его на дно большой кружки и залейте горячей водой (чем ближе к кипению и чем дольше вы варите, тем крепче будет ваш чай). Дайте перо развернуться на пару минут, затем сделайте глоток и примите горечь во всей красе. По мере того, как вы привыкните к его свойствам, попробуйте концентрировать дозу, употребляя меньше воды или больше чая.Горечь станет более интенсивной, и вместе с ней вы получите базовую сладость и успокаивающее действие на горло. Вот где чай кудинг превращается из травяной причуды в средство от головокружения. К тому времени, когда вы сделаете снимки в качестве своей утренней рутины, вы поймете, что это получилось.

.

Добавить комментарий

Ваш адрес email не будет опубликован.